Incidental Mutation 'R1416:Nsun7'
ID159577
Institutional Source Beutler Lab
Gene Symbol Nsun7
Ensembl Gene ENSMUSG00000029206
Gene NameNOL1/NOP2/Sun domain family, member 7
Synonyms4921525L17Rik
MMRRC Submission 039472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1416 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location66259897-66298026 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66261080 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 51 (V51A)
Ref Sequence ENSEMBL: ENSMUSP00000144498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031109] [ENSMUST00000201100] [ENSMUST00000202994]
Predicted Effect probably damaging
Transcript: ENSMUST00000031109
AA Change: V51A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031109
Gene: ENSMUSG00000029206
AA Change: V51A

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 394 477 4.2e-7 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113720
AA Change: V51A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109349
Gene: ENSMUSG00000029206
AA Change: V51A

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 312 479 4.4e-9 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200891
Predicted Effect probably damaging
Transcript: ENSMUST00000201100
AA Change: V51A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144520
Gene: ENSMUSG00000029206
AA Change: V51A

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 312 479 4.3e-9 PFAM
low complexity region 543 555 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202994
AA Change: V51A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144498
Gene: ENSMUSG00000029206
AA Change: V51A

DomainStartEndE-ValueType
PDB:2B9E|A 205 479 5e-17 PDB
low complexity region 509 521 N/A INTRINSIC
Meta Mutation Damage Score 0.5864 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: This gene encodes a member of the NOL1/NOP2/sun domain RNA methyltransferase family. Mice with a mutation in this gene exhibit male sterility due to impaired sperm motility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Males homozygous for an ENU-induced mutation are either infertile or subfertile. Mutant sperm exhibit poor progressive motility linked to rigidity of the flagellar midpiece and abnormal electron density patterns in the mitochondrial sheath. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,246,938 Q2689* probably null Het
4932429P05Rik A T X: 89,753,677 M372L probably benign Het
Acad11 T C 9: 104,073,623 S49P probably damaging Het
Afm T C 5: 90,526,379 I250T possibly damaging Het
Alox5 G A 6: 116,423,145 Q278* probably null Het
Anxa7 G A 14: 20,462,707 R253C probably damaging Het
Arfgef1 T A 1: 10,172,939 T1059S probably damaging Het
Arpp21 T C 9: 112,179,129 E101G probably damaging Het
Bcr A T 10: 75,061,506 I161F possibly damaging Het
Ccdc141 T C 2: 77,014,796 E1309G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep41 C T 6: 30,657,357 S233N probably damaging Het
Col5a1 T G 2: 27,922,064 S53A unknown Het
Efnb2 A G 8: 8,622,329 probably null Het
Epb41l5 T C 1: 119,549,876 probably benign Het
Eri2 A G 7: 119,791,174 F77S probably damaging Het
Ern1 C T 11: 106,421,980 probably benign Het
Eya3 T C 4: 132,707,129 probably benign Het
Fam122b T C X: 53,246,146 *256W probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Icos T C 1: 60,994,643 L144P probably damaging Het
Ipo8 A G 6: 148,789,093 V717A probably benign Het
Lrp12 T C 15: 39,878,623 E232G probably damaging Het
Lrp1b A G 2: 40,998,216 I2344T probably damaging Het
Mettl5 A T 2: 69,871,289 F207I possibly damaging Het
Mtor G T 4: 148,491,414 E1342* probably null Het
Nrap A G 19: 56,327,293 Y1360H possibly damaging Het
Olfr1065 T C 2: 86,445,320 I221V probably benign Het
Olfr1160 T A 2: 88,006,571 Y60F probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr235 C A 19: 12,268,894 F221L probably benign Het
Olfr467 T C 7: 107,815,262 L228P probably damaging Het
Otud6b A C 4: 14,818,473 L143V probably damaging Het
Pp2d1 T C 17: 53,515,807 N77S probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raly G T 2: 154,857,353 G26* probably null Het
Rarb T C 14: 16,435,177 M290V possibly damaging Het
Rusc2 A G 4: 43,421,617 E679G possibly damaging Het
Scap T C 9: 110,384,773 V1268A probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Shisa3 C G 5: 67,611,434 P226A probably benign Het
Smox C T 2: 131,522,131 S481F probably damaging Het
Stard9 T C 2: 120,700,972 V2570A probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Sult4a1 C T 15: 84,086,646 R186Q probably benign Het
Taf2 G T 15: 55,038,410 A796E possibly damaging Het
Taf4b T C 18: 14,821,427 probably benign Het
Thbs4 G T 13: 92,761,533 Q593K probably benign Het
Tigd3 T C 19: 5,891,725 D459G probably benign Het
Tmem168 A T 6: 13,591,401 L472Q probably damaging Het
Tmem169 G T 1: 72,300,716 V102F probably damaging Het
Tmem241 T C 18: 11,993,574 T274A probably benign Het
Trip10 A G 17: 57,250,800 Y28C probably damaging Het
Ubp1 T C 9: 113,970,171 V398A probably benign Het
Ubr3 A G 2: 69,945,071 Y567C probably damaging Het
Uckl1 A T 2: 181,569,569 M489K possibly damaging Het
Ush2a C T 1: 188,436,883 P1074S probably damaging Het
Vmn1r62 T C 7: 5,675,905 V195A probably damaging Het
Vmn2r63 T A 7: 42,927,915 I400L probably benign Het
Vmn2r67 T A 7: 85,151,616 I371F probably benign Het
Wdr64 A G 1: 175,806,002 T940A probably benign Het
Zfp105 A T 9: 122,930,677 Y471F probably damaging Het
Zfp287 A T 11: 62,714,340 H580Q probably damaging Het
Other mutations in Nsun7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Nsun7 APN 5 66289503 missense probably benign 0.00
IGL01013:Nsun7 APN 5 66283601 missense possibly damaging 0.87
IGL01355:Nsun7 APN 5 66294868 missense probably damaging 1.00
IGL01768:Nsun7 APN 5 66278700 missense probably benign 0.11
IGL01914:Nsun7 APN 5 66276634 missense probably damaging 1.00
IGL01990:Nsun7 APN 5 66261073 missense probably damaging 1.00
IGL02477:Nsun7 APN 5 66276649 missense probably damaging 0.99
R0071:Nsun7 UTSW 5 66264045 missense probably benign 0.00
R0071:Nsun7 UTSW 5 66264045 missense probably benign 0.00
R0079:Nsun7 UTSW 5 66295513 missense probably benign 0.00
R0255:Nsun7 UTSW 5 66289408 splice site probably benign
R0503:Nsun7 UTSW 5 66283581 splice site probably benign
R0540:Nsun7 UTSW 5 66283634 missense probably damaging 0.98
R1471:Nsun7 UTSW 5 66284229 missense probably benign 0.00
R1942:Nsun7 UTSW 5 66284245 missense probably benign 0.00
R1981:Nsun7 UTSW 5 66261214 missense probably damaging 0.99
R2037:Nsun7 UTSW 5 66261086 missense probably benign 0.06
R2098:Nsun7 UTSW 5 66283712 missense probably damaging 0.98
R2226:Nsun7 UTSW 5 66261219 nonsense probably null
R2996:Nsun7 UTSW 5 66295554 missense probably benign 0.01
R3882:Nsun7 UTSW 5 66278640 missense probably damaging 0.99
R4678:Nsun7 UTSW 5 66261064 missense probably benign 0.00
R4681:Nsun7 UTSW 5 66261199 missense probably benign 0.00
R4997:Nsun7 UTSW 5 66295839 missense probably benign 0.02
R6108:Nsun7 UTSW 5 66295799 missense probably damaging 0.99
R6465:Nsun7 UTSW 5 66295586 missense probably benign 0.35
R6500:Nsun7 UTSW 5 66295484 missense probably benign 0.11
R6746:Nsun7 UTSW 5 66283737 critical splice donor site probably null
R6925:Nsun7 UTSW 5 66277072 missense probably damaging 1.00
R7032:Nsun7 UTSW 5 66264035 missense probably benign 0.02
R7084:Nsun7 UTSW 5 66295421 missense probably damaging 1.00
R7098:Nsun7 UTSW 5 66260983 missense probably damaging 0.98
R7216:Nsun7 UTSW 5 66278657 missense probably damaging 1.00
R7276:Nsun7 UTSW 5 66277141 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCGATGGGCTAGTACATGTCATGTC -3'
(R):5'- ACACTTCAGGGTACTGAAAGCCAAC -3'

Sequencing Primer
(F):5'- gaaaagagagagagagagagagag -3'
(R):5'- GGGTACTGAAAGCCAACTCATAG -3'
Posted On2014-03-14