Incidental Mutation 'R1416:Scap'
ID159594
Institutional Source Beutler Lab
Gene Symbol Scap
Ensembl Gene ENSMUSG00000032485
Gene NameSREBF chaperone
Synonyms
MMRRC Submission 039472-MU
Accession Numbers

Genbank: NM_001001144; MGI: 2135958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1416 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110333288-110384950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110384773 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1268 (V1268A)
Ref Sequence ENSEMBL: ENSMUSP00000095953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040021] [ENSMUST00000098350]
Predicted Effect probably benign
Transcript: ENSMUST00000040021
SMART Domains Protein: ENSMUSP00000039580
Gene: ENSMUSG00000036057

DomainStartEndE-ValueType
BRO1 8 384 5.94e-159 SMART
Pfam:ALIX_LYPXL_bnd 416 704 1.4e-64 PFAM
low complexity region 715 728 N/A INTRINSIC
low complexity region 774 785 N/A INTRINSIC
low complexity region 849 858 N/A INTRINSIC
low complexity region 905 928 N/A INTRINSIC
internal_repeat_1 929 942 8.2e-5 PROSPERO
internal_repeat_1 943 956 8.2e-5 PROSPERO
low complexity region 977 1018 N/A INTRINSIC
low complexity region 1040 1061 N/A INTRINSIC
low complexity region 1088 1106 N/A INTRINSIC
low complexity region 1128 1160 N/A INTRINSIC
low complexity region 1185 1200 N/A INTRINSIC
low complexity region 1225 1235 N/A INTRINSIC
PTPc 1246 1510 1.28e-92 SMART
low complexity region 1576 1587 N/A INTRINSIC
low complexity region 1589 1643 N/A INTRINSIC
Blast:PTPc 1644 1673 9e-8 BLAST
low complexity region 1675 1689 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098350
AA Change: V1268A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485
AA Change: V1268A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200278
Predicted Effect probably benign
Transcript: ENSMUST00000200531
Meta Mutation Damage Score 0.3246 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The SREBPs are then proteolytically cleaved and regulate sterol biosynthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, other(1) Gene trapped(22)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,246,938 Q2689* probably null Het
4932429P05Rik A T X: 89,753,677 M372L probably benign Het
Acad11 T C 9: 104,073,623 S49P probably damaging Het
Afm T C 5: 90,526,379 I250T possibly damaging Het
Alox5 G A 6: 116,423,145 Q278* probably null Het
Anxa7 G A 14: 20,462,707 R253C probably damaging Het
Arfgef1 T A 1: 10,172,939 T1059S probably damaging Het
Arpp21 T C 9: 112,179,129 E101G probably damaging Het
Bcr A T 10: 75,061,506 I161F possibly damaging Het
Ccdc141 T C 2: 77,014,796 E1309G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep41 C T 6: 30,657,357 S233N probably damaging Het
Col5a1 T G 2: 27,922,064 S53A unknown Het
Efnb2 A G 8: 8,622,329 probably null Het
Epb41l5 T C 1: 119,549,876 probably benign Het
Eri2 A G 7: 119,791,174 F77S probably damaging Het
Ern1 C T 11: 106,421,980 probably benign Het
Eya3 T C 4: 132,707,129 probably benign Het
Fam122b T C X: 53,246,146 *256W probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Icos T C 1: 60,994,643 L144P probably damaging Het
Ipo8 A G 6: 148,789,093 V717A probably benign Het
Lrp12 T C 15: 39,878,623 E232G probably damaging Het
Lrp1b A G 2: 40,998,216 I2344T probably damaging Het
Mettl5 A T 2: 69,871,289 F207I possibly damaging Het
Mtor G T 4: 148,491,414 E1342* probably null Het
Nrap A G 19: 56,327,293 Y1360H possibly damaging Het
Nsun7 T C 5: 66,261,080 V51A probably damaging Het
Olfr1065 T C 2: 86,445,320 I221V probably benign Het
Olfr1160 T A 2: 88,006,571 Y60F probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr235 C A 19: 12,268,894 F221L probably benign Het
Olfr467 T C 7: 107,815,262 L228P probably damaging Het
Otud6b A C 4: 14,818,473 L143V probably damaging Het
Pp2d1 T C 17: 53,515,807 N77S probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raly G T 2: 154,857,353 G26* probably null Het
Rarb T C 14: 16,435,177 M290V possibly damaging Het
Rusc2 A G 4: 43,421,617 E679G possibly damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Shisa3 C G 5: 67,611,434 P226A probably benign Het
Smox C T 2: 131,522,131 S481F probably damaging Het
Stard9 T C 2: 120,700,972 V2570A probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Sult4a1 C T 15: 84,086,646 R186Q probably benign Het
Taf2 G T 15: 55,038,410 A796E possibly damaging Het
Taf4b T C 18: 14,821,427 probably benign Het
Thbs4 G T 13: 92,761,533 Q593K probably benign Het
Tigd3 T C 19: 5,891,725 D459G probably benign Het
Tmem168 A T 6: 13,591,401 L472Q probably damaging Het
Tmem169 G T 1: 72,300,716 V102F probably damaging Het
Tmem241 T C 18: 11,993,574 T274A probably benign Het
Trip10 A G 17: 57,250,800 Y28C probably damaging Het
Ubp1 T C 9: 113,970,171 V398A probably benign Het
Ubr3 A G 2: 69,945,071 Y567C probably damaging Het
Uckl1 A T 2: 181,569,569 M489K possibly damaging Het
Ush2a C T 1: 188,436,883 P1074S probably damaging Het
Vmn1r62 T C 7: 5,675,905 V195A probably damaging Het
Vmn2r63 T A 7: 42,927,915 I400L probably benign Het
Vmn2r67 T A 7: 85,151,616 I371F probably benign Het
Wdr64 A G 1: 175,806,002 T940A probably benign Het
Zfp105 A T 9: 122,930,677 Y471F probably damaging Het
Zfp287 A T 11: 62,714,340 H580Q probably damaging Het
Other mutations in Scap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Scap APN 9 110376631 missense probably damaging 1.00
IGL01012:Scap APN 9 110362420 missense probably damaging 1.00
IGL01487:Scap APN 9 110377734 critical splice donor site probably null
IGL01634:Scap APN 9 110378789 critical splice donor site probably null
IGL01725:Scap APN 9 110381554 unclassified probably benign
IGL01939:Scap APN 9 110379481 missense probably benign 0.02
IGL02106:Scap APN 9 110381656 unclassified probably benign
IGL02423:Scap APN 9 110378617 missense probably benign 0.02
IGL02487:Scap APN 9 110378690 missense probably benign 0.19
IGL02545:Scap APN 9 110378690 missense probably benign 0.19
IGL03226:Scap APN 9 110384267 missense possibly damaging 0.93
IGL03331:Scap APN 9 110380236 unclassified probably null
3-1:Scap UTSW 9 110372968 intron probably benign
R0027:Scap UTSW 9 110379730 missense probably benign 0.06
R0089:Scap UTSW 9 110372222 missense possibly damaging 0.81
R0742:Scap UTSW 9 110381259 missense probably damaging 1.00
R1785:Scap UTSW 9 110374055 missense probably damaging 0.97
R1996:Scap UTSW 9 110372971 intron probably benign
R2114:Scap UTSW 9 110381273 missense probably damaging 0.99
R2189:Scap UTSW 9 110377693 missense probably damaging 1.00
R2233:Scap UTSW 9 110381593 missense probably damaging 0.98
R2234:Scap UTSW 9 110381593 missense probably damaging 0.98
R2656:Scap UTSW 9 110374019 missense probably damaging 1.00
R3176:Scap UTSW 9 110374025 missense probably benign
R3237:Scap UTSW 9 110379582 missense probably damaging 0.96
R3276:Scap UTSW 9 110374025 missense probably benign
R3623:Scap UTSW 9 110380203 missense probably damaging 0.99
R3826:Scap UTSW 9 110381297 missense probably benign
R4859:Scap UTSW 9 110374342 unclassified probably benign
R4993:Scap UTSW 9 110378390 missense probably damaging 1.00
R5052:Scap UTSW 9 110353152 missense possibly damaging 0.89
R5330:Scap UTSW 9 110381633 missense probably benign 0.00
R5331:Scap UTSW 9 110381633 missense probably benign 0.00
R5383:Scap UTSW 9 110374529 missense probably damaging 0.99
R5410:Scap UTSW 9 110374182 unclassified probably null
R5531:Scap UTSW 9 110381429 missense possibly damaging 0.59
R5567:Scap UTSW 9 110377644 missense probably damaging 1.00
R5636:Scap UTSW 9 110380594 missense probably damaging 0.99
R5637:Scap UTSW 9 110381572 missense possibly damaging 0.94
R5859:Scap UTSW 9 110374047 missense probably benign 0.14
R5923:Scap UTSW 9 110383580 missense probably damaging 0.98
R5945:Scap UTSW 9 110384596 missense probably benign 0.00
R5987:Scap UTSW 9 110381151 missense probably damaging 1.00
R6075:Scap UTSW 9 110378777 missense probably damaging 1.00
R6130:Scap UTSW 9 110380379 missense possibly damaging 0.95
R6190:Scap UTSW 9 110374067 missense probably benign 0.01
R6567:Scap UTSW 9 110383562 missense probably damaging 1.00
R6999:Scap UTSW 9 110384647 missense probably damaging 1.00
R7098:Scap UTSW 9 110372242 missense possibly damaging 0.89
R7386:Scap UTSW 9 110373169 missense probably benign 0.00
R7642:Scap UTSW 9 110374013 missense probably damaging 1.00
X0064:Scap UTSW 9 110377645 missense probably damaging 1.00
Z1088:Scap UTSW 9 110372336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAACATTGAAGACCTCTTCTGCC -3'
(R):5'- TGGAATGACAAGAACTTCAGCCCC -3'

Sequencing Primer
(F):5'- AGCTTGGGTGTCATCTCAGATAAC -3'
(R):5'- TCAGCCCCTGGTAAATGTG -3'
Posted On2014-03-14