Incidental Mutation 'R1416:Zfp287'
ID159599
Institutional Source Beutler Lab
Gene Symbol Zfp287
Ensembl Gene ENSMUSG00000005267
Gene Namezinc finger protein 287
SynonymsB230333C16Rik, SKAT-2
MMRRC Submission 039472-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1416 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location62700356-62731905 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62714340 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 580 (H580Q)
Ref Sequence ENSEMBL: ENSMUSP00000141046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005399] [ENSMUST00000149228] [ENSMUST00000150336] [ENSMUST00000185656]
Predicted Effect probably damaging
Transcript: ENSMUST00000005399
AA Change: H569Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000005399
Gene: ENSMUSG00000005267
AA Change: H569Q

DomainStartEndE-ValueType
SCAN 27 138 1e-50 SMART
KRAB 155 212 5.79e-20 SMART
low complexity region 253 262 N/A INTRINSIC
ZnF_C2H2 355 377 5.9e-3 SMART
ZnF_C2H2 383 405 2.61e-4 SMART
ZnF_C2H2 411 433 5.59e-4 SMART
ZnF_C2H2 439 461 3.44e-4 SMART
ZnF_C2H2 467 489 9.73e-4 SMART
ZnF_C2H2 495 517 2.43e-4 SMART
ZnF_C2H2 523 545 4.54e-4 SMART
ZnF_C2H2 551 573 2.57e-3 SMART
ZnF_C2H2 579 601 4.87e-4 SMART
ZnF_C2H2 607 629 1.3e-4 SMART
ZnF_C2H2 635 657 4.79e-3 SMART
ZnF_C2H2 663 685 2.95e-3 SMART
ZnF_C2H2 691 713 3.63e-3 SMART
ZnF_C2H2 719 741 1.38e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149228
AA Change: H580Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114531
Gene: ENSMUSG00000005267
AA Change: H580Q

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
low complexity region 264 273 N/A INTRINSIC
ZnF_C2H2 366 388 5.9e-3 SMART
ZnF_C2H2 394 416 2.61e-4 SMART
ZnF_C2H2 422 444 5.59e-4 SMART
ZnF_C2H2 450 472 3.44e-4 SMART
ZnF_C2H2 478 500 9.73e-4 SMART
ZnF_C2H2 506 528 2.43e-4 SMART
ZnF_C2H2 534 556 4.54e-4 SMART
ZnF_C2H2 562 584 2.57e-3 SMART
ZnF_C2H2 590 612 4.87e-4 SMART
ZnF_C2H2 618 640 1.3e-4 SMART
ZnF_C2H2 646 668 4.79e-3 SMART
ZnF_C2H2 674 696 2.95e-3 SMART
ZnF_C2H2 702 724 3.63e-3 SMART
ZnF_C2H2 730 752 1.38e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150336
SMART Domains Protein: ENSMUSP00000121717
Gene: ENSMUSG00000005267

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185656
AA Change: H580Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141046
Gene: ENSMUSG00000005267
AA Change: H580Q

DomainStartEndE-ValueType
SCAN 38 149 1e-50 SMART
KRAB 166 223 5.79e-20 SMART
low complexity region 264 273 N/A INTRINSIC
ZnF_C2H2 366 388 5.9e-3 SMART
ZnF_C2H2 394 416 2.61e-4 SMART
ZnF_C2H2 422 444 5.59e-4 SMART
ZnF_C2H2 450 472 3.44e-4 SMART
ZnF_C2H2 478 500 9.73e-4 SMART
ZnF_C2H2 506 528 2.43e-4 SMART
ZnF_C2H2 534 556 4.54e-4 SMART
ZnF_C2H2 562 584 2.57e-3 SMART
ZnF_C2H2 590 612 4.87e-4 SMART
ZnF_C2H2 618 640 1.3e-4 SMART
ZnF_C2H2 646 668 4.79e-3 SMART
ZnF_C2H2 674 696 2.95e-3 SMART
ZnF_C2H2 702 724 3.63e-3 SMART
ZnF_C2H2 730 752 1.38e-3 SMART
Meta Mutation Damage Score 0.6555 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the krueppel family of zinc finger proteins, suggesting a role as a transcription factor. Its specific function has not been determined. This gene is located near the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,246,938 Q2689* probably null Het
4932429P05Rik A T X: 89,753,677 M372L probably benign Het
Acad11 T C 9: 104,073,623 S49P probably damaging Het
Afm T C 5: 90,526,379 I250T possibly damaging Het
Alox5 G A 6: 116,423,145 Q278* probably null Het
Anxa7 G A 14: 20,462,707 R253C probably damaging Het
Arfgef1 T A 1: 10,172,939 T1059S probably damaging Het
Arpp21 T C 9: 112,179,129 E101G probably damaging Het
Bcr A T 10: 75,061,506 I161F possibly damaging Het
Ccdc141 T C 2: 77,014,796 E1309G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep41 C T 6: 30,657,357 S233N probably damaging Het
Col5a1 T G 2: 27,922,064 S53A unknown Het
Efnb2 A G 8: 8,622,329 probably null Het
Epb41l5 T C 1: 119,549,876 probably benign Het
Eri2 A G 7: 119,791,174 F77S probably damaging Het
Ern1 C T 11: 106,421,980 probably benign Het
Eya3 T C 4: 132,707,129 probably benign Het
Fam122b T C X: 53,246,146 *256W probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Icos T C 1: 60,994,643 L144P probably damaging Het
Ipo8 A G 6: 148,789,093 V717A probably benign Het
Lrp12 T C 15: 39,878,623 E232G probably damaging Het
Lrp1b A G 2: 40,998,216 I2344T probably damaging Het
Mettl5 A T 2: 69,871,289 F207I possibly damaging Het
Mtor G T 4: 148,491,414 E1342* probably null Het
Nrap A G 19: 56,327,293 Y1360H possibly damaging Het
Nsun7 T C 5: 66,261,080 V51A probably damaging Het
Olfr1065 T C 2: 86,445,320 I221V probably benign Het
Olfr1160 T A 2: 88,006,571 Y60F probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr235 C A 19: 12,268,894 F221L probably benign Het
Olfr467 T C 7: 107,815,262 L228P probably damaging Het
Otud6b A C 4: 14,818,473 L143V probably damaging Het
Pp2d1 T C 17: 53,515,807 N77S probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raly G T 2: 154,857,353 G26* probably null Het
Rarb T C 14: 16,435,177 M290V possibly damaging Het
Rusc2 A G 4: 43,421,617 E679G possibly damaging Het
Scap T C 9: 110,384,773 V1268A probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Shisa3 C G 5: 67,611,434 P226A probably benign Het
Smox C T 2: 131,522,131 S481F probably damaging Het
Stard9 T C 2: 120,700,972 V2570A probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Sult4a1 C T 15: 84,086,646 R186Q probably benign Het
Taf2 G T 15: 55,038,410 A796E possibly damaging Het
Taf4b T C 18: 14,821,427 probably benign Het
Thbs4 G T 13: 92,761,533 Q593K probably benign Het
Tigd3 T C 19: 5,891,725 D459G probably benign Het
Tmem168 A T 6: 13,591,401 L472Q probably damaging Het
Tmem169 G T 1: 72,300,716 V102F probably damaging Het
Tmem241 T C 18: 11,993,574 T274A probably benign Het
Trip10 A G 17: 57,250,800 Y28C probably damaging Het
Ubp1 T C 9: 113,970,171 V398A probably benign Het
Ubr3 A G 2: 69,945,071 Y567C probably damaging Het
Uckl1 A T 2: 181,569,569 M489K possibly damaging Het
Ush2a C T 1: 188,436,883 P1074S probably damaging Het
Vmn1r62 T C 7: 5,675,905 V195A probably damaging Het
Vmn2r63 T A 7: 42,927,915 I400L probably benign Het
Vmn2r67 T A 7: 85,151,616 I371F probably benign Het
Wdr64 A G 1: 175,806,002 T940A probably benign Het
Zfp105 A T 9: 122,930,677 Y471F probably damaging Het
Other mutations in Zfp287
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Zfp287 APN 11 62713890 nonsense probably null
IGL01868:Zfp287 APN 11 62715257 missense probably benign 0.22
IGL03290:Zfp287 APN 11 62715236 missense probably damaging 0.98
R0064:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R0064:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R0193:Zfp287 UTSW 11 62715029 missense probably benign 0.12
R0211:Zfp287 UTSW 11 62714917 missense probably damaging 0.99
R0211:Zfp287 UTSW 11 62714917 missense probably damaging 0.99
R0525:Zfp287 UTSW 11 62715244 missense probably benign
R0725:Zfp287 UTSW 11 62714213 missense probably damaging 1.00
R1405:Zfp287 UTSW 11 62728311 missense probably damaging 1.00
R1405:Zfp287 UTSW 11 62728311 missense probably damaging 1.00
R1487:Zfp287 UTSW 11 62725289 missense probably damaging 1.00
R2023:Zfp287 UTSW 11 62714982 nonsense probably null
R2045:Zfp287 UTSW 11 62727569 missense probably damaging 1.00
R2495:Zfp287 UTSW 11 62714633 missense probably damaging 1.00
R3794:Zfp287 UTSW 11 62714244 missense probably damaging 1.00
R3902:Zfp287 UTSW 11 62712202 missense probably benign 0.00
R4816:Zfp287 UTSW 11 62714248 missense probably damaging 1.00
R4928:Zfp287 UTSW 11 62714136 nonsense probably null
R5048:Zfp287 UTSW 11 62714951 missense probably damaging 0.98
R5858:Zfp287 UTSW 11 62714007 missense probably damaging 1.00
R6349:Zfp287 UTSW 11 62725342 missense probably damaging 0.99
R6964:Zfp287 UTSW 11 62724817 missense probably damaging 1.00
R7024:Zfp287 UTSW 11 62714938 missense possibly damaging 0.68
R7252:Zfp287 UTSW 11 62724829 missense probably damaging 1.00
R7318:Zfp287 UTSW 11 62714278 missense probably damaging 1.00
R7548:Zfp287 UTSW 11 62713875 nonsense probably null
R7658:Zfp287 UTSW 11 62725263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGGTTTGCACCCTGTCTGT -3'
(R):5'- GCGGCAAAGAATTTAAGCATCTCTCCT -3'

Sequencing Primer
(F):5'- gcttttctccattgtgaatcctc -3'
(R):5'- cagtcagcgagcacacc -3'
Posted On2014-03-14