Incidental Mutation 'R1416:Sucla2'
ID159604
Institutional Source Beutler Lab
Gene Symbol Sucla2
Ensembl Gene ENSMUSG00000022110
Gene Namesuccinate-Coenzyme A ligase, ADP-forming, beta subunit
Synonyms4930547K18Rik
MMRRC Submission 039472-MU
Accession Numbers

Genbank: NM_011506; MGI: 1306775

Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R1416 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location73525319-73596142 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 73560634 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022706] [ENSMUST00000160507] [ENSMUST00000162691]
Predicted Effect probably benign
Transcript: ENSMUST00000022706
SMART Domains Protein: ENSMUSP00000022706
Gene: ENSMUSG00000022110

DomainStartEndE-ValueType
Pfam:ATP-grasp_5 44 277 1.6e-11 PFAM
Pfam:ATP-grasp_2 54 262 9.2e-78 PFAM
Pfam:Ligase_CoA 321 441 2.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160507
SMART Domains Protein: ENSMUSP00000123765
Gene: ENSMUSG00000022110

DomainStartEndE-ValueType
Pfam:ATP-grasp_5 44 277 3e-11 PFAM
Pfam:ATP-grasp_2 54 262 9.5e-77 PFAM
Pfam:Ligase_CoA 321 441 2.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162723
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Succinyl-CoA synthetase (SCS) is a mitochondrial matrix enzyme that acts as a heterodimer, being composed of an invariant alpha subunit and a substrate-specific beta subunit. The protein encoded by this gene is an ATP-specific SCS beta subunit that dimerizes with the SCS alpha subunit to form SCS-A, an essential component of the tricarboxylic acid cycle. SCS-A hydrolyzes ATP to convert succinate to succinyl-CoA. Defects in this gene are a cause of myopathic mitochondrial DNA depletion syndrome. A pseudogene of this gene has been found on chromosome 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit perinatal lethality with reduced size, placenta mineralization, decreased mitochondrial DNA and respiration. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,246,938 Q2689* probably null Het
4932429P05Rik A T X: 89,753,677 M372L probably benign Het
Acad11 T C 9: 104,073,623 S49P probably damaging Het
Afm T C 5: 90,526,379 I250T possibly damaging Het
Alox5 G A 6: 116,423,145 Q278* probably null Het
Anxa7 G A 14: 20,462,707 R253C probably damaging Het
Arfgef1 T A 1: 10,172,939 T1059S probably damaging Het
Arpp21 T C 9: 112,179,129 E101G probably damaging Het
Bcr A T 10: 75,061,506 I161F possibly damaging Het
Ccdc141 T C 2: 77,014,796 E1309G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep41 C T 6: 30,657,357 S233N probably damaging Het
Col5a1 T G 2: 27,922,064 S53A unknown Het
Efnb2 A G 8: 8,622,329 probably null Het
Epb41l5 T C 1: 119,549,876 probably benign Het
Eri2 A G 7: 119,791,174 F77S probably damaging Het
Ern1 C T 11: 106,421,980 probably benign Het
Eya3 T C 4: 132,707,129 probably benign Het
Fam122b T C X: 53,246,146 *256W probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Icos T C 1: 60,994,643 L144P probably damaging Het
Ipo8 A G 6: 148,789,093 V717A probably benign Het
Lrp12 T C 15: 39,878,623 E232G probably damaging Het
Lrp1b A G 2: 40,998,216 I2344T probably damaging Het
Mettl5 A T 2: 69,871,289 F207I possibly damaging Het
Mtor G T 4: 148,491,414 E1342* probably null Het
Nrap A G 19: 56,327,293 Y1360H possibly damaging Het
Nsun7 T C 5: 66,261,080 V51A probably damaging Het
Olfr1065 T C 2: 86,445,320 I221V probably benign Het
Olfr1160 T A 2: 88,006,571 Y60F probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr235 C A 19: 12,268,894 F221L probably benign Het
Olfr467 T C 7: 107,815,262 L228P probably damaging Het
Otud6b A C 4: 14,818,473 L143V probably damaging Het
Pp2d1 T C 17: 53,515,807 N77S probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raly G T 2: 154,857,353 G26* probably null Het
Rarb T C 14: 16,435,177 M290V possibly damaging Het
Rusc2 A G 4: 43,421,617 E679G possibly damaging Het
Scap T C 9: 110,384,773 V1268A probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Shisa3 C G 5: 67,611,434 P226A probably benign Het
Smox C T 2: 131,522,131 S481F probably damaging Het
Stard9 T C 2: 120,700,972 V2570A probably benign Het
Sult4a1 C T 15: 84,086,646 R186Q probably benign Het
Taf2 G T 15: 55,038,410 A796E possibly damaging Het
Taf4b T C 18: 14,821,427 probably benign Het
Thbs4 G T 13: 92,761,533 Q593K probably benign Het
Tigd3 T C 19: 5,891,725 D459G probably benign Het
Tmem168 A T 6: 13,591,401 L472Q probably damaging Het
Tmem169 G T 1: 72,300,716 V102F probably damaging Het
Tmem241 T C 18: 11,993,574 T274A probably benign Het
Trip10 A G 17: 57,250,800 Y28C probably damaging Het
Ubp1 T C 9: 113,970,171 V398A probably benign Het
Ubr3 A G 2: 69,945,071 Y567C probably damaging Het
Uckl1 A T 2: 181,569,569 M489K possibly damaging Het
Ush2a C T 1: 188,436,883 P1074S probably damaging Het
Vmn1r62 T C 7: 5,675,905 V195A probably damaging Het
Vmn2r63 T A 7: 42,927,915 I400L probably benign Het
Vmn2r67 T A 7: 85,151,616 I371F probably benign Het
Wdr64 A G 1: 175,806,002 T940A probably benign Het
Zfp105 A T 9: 122,930,677 Y471F probably damaging Het
Zfp287 A T 11: 62,714,340 H580Q probably damaging Het
Other mutations in Sucla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Sucla2 APN 14 73590907 missense possibly damaging 0.81
IGL01539:Sucla2 APN 14 73591121 missense probably damaging 0.97
IGL02064:Sucla2 APN 14 73579473 nonsense probably null
IGL02240:Sucla2 APN 14 73590847 missense probably damaging 1.00
IGL02640:Sucla2 APN 14 73581806 missense probably benign 0.45
IGL02965:Sucla2 APN 14 73579431 missense probably benign 0.00
3-1:Sucla2 UTSW 14 73568957 nonsense probably null
PIT4812001:Sucla2 UTSW 14 73579449 missense possibly damaging 0.89
R0189:Sucla2 UTSW 14 73592648 missense probably damaging 1.00
R0764:Sucla2 UTSW 14 73560634 unclassified probably benign
R0765:Sucla2 UTSW 14 73560634 unclassified probably benign
R0844:Sucla2 UTSW 14 73560634 unclassified probably benign
R1065:Sucla2 UTSW 14 73560634 unclassified probably benign
R1067:Sucla2 UTSW 14 73560634 unclassified probably benign
R1136:Sucla2 UTSW 14 73560634 unclassified probably benign
R1162:Sucla2 UTSW 14 73560634 unclassified probably benign
R1311:Sucla2 UTSW 14 73560634 unclassified probably benign
R1312:Sucla2 UTSW 14 73560634 unclassified probably benign
R1345:Sucla2 UTSW 14 73560634 unclassified probably benign
R1677:Sucla2 UTSW 14 73592681 missense probably damaging 1.00
R1968:Sucla2 UTSW 14 73593679 missense probably damaging 0.99
R2126:Sucla2 UTSW 14 73592668 missense possibly damaging 0.71
R2484:Sucla2 UTSW 14 73581709 missense probably benign 0.12
R2566:Sucla2 UTSW 14 73552804 intron probably benign
R3706:Sucla2 UTSW 14 73591052 missense probably damaging 1.00
R4725:Sucla2 UTSW 14 73568989 missense possibly damaging 0.94
R5620:Sucla2 UTSW 14 73595396 missense probably damaging 0.99
R5650:Sucla2 UTSW 14 73591129 missense probably benign 0.38
R5947:Sucla2 UTSW 14 73592669 missense probably damaging 1.00
R6045:Sucla2 UTSW 14 73568964 nonsense probably null
R6236:Sucla2 UTSW 14 73593750 missense probably benign 0.39
R6693:Sucla2 UTSW 14 73568667 nonsense probably null
R7706:Sucla2 UTSW 14 73568993 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACTACAAGTGCAGCAGCAG -3'
(R):5'- GCTAAAAGGAGGACTTCAGCACCC -3'

Sequencing Primer
(F):5'- AGCAGCAGAGGACCCTTTC -3'
(R):5'- TCCTCAAAAACAAGCCaagtcaaac -3'
Posted On2014-03-14