Incidental Mutation 'R1416:Pp2d1'
ID159609
Institutional Source Beutler Lab
Gene Symbol Pp2d1
Ensembl Gene ENSMUSG00000044957
Gene Nameprotein phosphatase 2C-like domain containing 1
Synonyms
MMRRC Submission 039472-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1416 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location53507460-53539451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53515807 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 77 (N77S)
Ref Sequence ENSEMBL: ENSMUSP00000056682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056198]
Predicted Effect probably benign
Transcript: ENSMUST00000056198
AA Change: N77S

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000056682
Gene: ENSMUSG00000044957
AA Change: N77S

DomainStartEndE-ValueType
PP2Cc 173 609 4.04e-18 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.1%
Validation Efficiency 94% (63/67)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik C T 15: 8,246,938 Q2689* probably null Het
4932429P05Rik A T X: 89,753,677 M372L probably benign Het
Acad11 T C 9: 104,073,623 S49P probably damaging Het
Afm T C 5: 90,526,379 I250T possibly damaging Het
Alox5 G A 6: 116,423,145 Q278* probably null Het
Anxa7 G A 14: 20,462,707 R253C probably damaging Het
Arfgef1 T A 1: 10,172,939 T1059S probably damaging Het
Arpp21 T C 9: 112,179,129 E101G probably damaging Het
Bcr A T 10: 75,061,506 I161F possibly damaging Het
Ccdc141 T C 2: 77,014,796 E1309G probably damaging Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cep41 C T 6: 30,657,357 S233N probably damaging Het
Col5a1 T G 2: 27,922,064 S53A unknown Het
Efnb2 A G 8: 8,622,329 probably null Het
Epb41l5 T C 1: 119,549,876 probably benign Het
Eri2 A G 7: 119,791,174 F77S probably damaging Het
Ern1 C T 11: 106,421,980 probably benign Het
Eya3 T C 4: 132,707,129 probably benign Het
Fam122b T C X: 53,246,146 *256W probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Icos T C 1: 60,994,643 L144P probably damaging Het
Ipo8 A G 6: 148,789,093 V717A probably benign Het
Lrp12 T C 15: 39,878,623 E232G probably damaging Het
Lrp1b A G 2: 40,998,216 I2344T probably damaging Het
Mettl5 A T 2: 69,871,289 F207I possibly damaging Het
Mtor G T 4: 148,491,414 E1342* probably null Het
Nrap A G 19: 56,327,293 Y1360H possibly damaging Het
Nsun7 T C 5: 66,261,080 V51A probably damaging Het
Olfr1065 T C 2: 86,445,320 I221V probably benign Het
Olfr1160 T A 2: 88,006,571 Y60F probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr235 C A 19: 12,268,894 F221L probably benign Het
Olfr467 T C 7: 107,815,262 L228P probably damaging Het
Otud6b A C 4: 14,818,473 L143V probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Raly G T 2: 154,857,353 G26* probably null Het
Rarb T C 14: 16,435,177 M290V possibly damaging Het
Rusc2 A G 4: 43,421,617 E679G possibly damaging Het
Scap T C 9: 110,384,773 V1268A probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Shisa3 C G 5: 67,611,434 P226A probably benign Het
Smox C T 2: 131,522,131 S481F probably damaging Het
Stard9 T C 2: 120,700,972 V2570A probably benign Het
Sucla2 C T 14: 73,560,634 probably benign Het
Sult4a1 C T 15: 84,086,646 R186Q probably benign Het
Taf2 G T 15: 55,038,410 A796E possibly damaging Het
Taf4b T C 18: 14,821,427 probably benign Het
Thbs4 G T 13: 92,761,533 Q593K probably benign Het
Tigd3 T C 19: 5,891,725 D459G probably benign Het
Tmem168 A T 6: 13,591,401 L472Q probably damaging Het
Tmem169 G T 1: 72,300,716 V102F probably damaging Het
Tmem241 T C 18: 11,993,574 T274A probably benign Het
Trip10 A G 17: 57,250,800 Y28C probably damaging Het
Ubp1 T C 9: 113,970,171 V398A probably benign Het
Ubr3 A G 2: 69,945,071 Y567C probably damaging Het
Uckl1 A T 2: 181,569,569 M489K possibly damaging Het
Ush2a C T 1: 188,436,883 P1074S probably damaging Het
Vmn1r62 T C 7: 5,675,905 V195A probably damaging Het
Vmn2r63 T A 7: 42,927,915 I400L probably benign Het
Vmn2r67 T A 7: 85,151,616 I371F probably benign Het
Wdr64 A G 1: 175,806,002 T940A probably benign Het
Zfp105 A T 9: 122,930,677 Y471F probably damaging Het
Zfp287 A T 11: 62,714,340 H580Q probably damaging Het
Other mutations in Pp2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Pp2d1 APN 17 53515639 missense probably benign 0.00
IGL01939:Pp2d1 APN 17 53515139 missense probably damaging 1.00
IGL02031:Pp2d1 APN 17 53508440 missense probably damaging 1.00
IGL02039:Pp2d1 APN 17 53515994 nonsense probably null
IGL02108:Pp2d1 APN 17 53515405 missense probably damaging 1.00
IGL02121:Pp2d1 APN 17 53507921 missense probably damaging 1.00
IGL03034:Pp2d1 APN 17 53508053 missense possibly damaging 0.88
R0483:Pp2d1 UTSW 17 53507971 missense probably benign 0.29
R0562:Pp2d1 UTSW 17 53539168 splice site probably benign
R1464:Pp2d1 UTSW 17 53515987 missense possibly damaging 0.94
R1464:Pp2d1 UTSW 17 53515987 missense possibly damaging 0.94
R1479:Pp2d1 UTSW 17 53507855 missense probably benign 0.05
R1659:Pp2d1 UTSW 17 53515378 missense possibly damaging 0.50
R1711:Pp2d1 UTSW 17 53515310 missense possibly damaging 0.47
R2214:Pp2d1 UTSW 17 53515396 missense probably benign 0.01
R2217:Pp2d1 UTSW 17 53515454 missense probably benign 0.02
R2218:Pp2d1 UTSW 17 53515454 missense probably benign 0.02
R4463:Pp2d1 UTSW 17 53515858 missense probably benign
R4644:Pp2d1 UTSW 17 53515987 missense probably benign 0.00
R4901:Pp2d1 UTSW 17 53515009 missense probably benign 0.20
R5164:Pp2d1 UTSW 17 53508070 missense probably benign 0.11
R5169:Pp2d1 UTSW 17 53507902 missense possibly damaging 0.78
R5186:Pp2d1 UTSW 17 53508140 missense probably benign
R5223:Pp2d1 UTSW 17 53507845 missense probably benign 0.12
R6550:Pp2d1 UTSW 17 53515576 missense probably damaging 0.98
R6918:Pp2d1 UTSW 17 53515459 missense probably damaging 0.99
R7263:Pp2d1 UTSW 17 53515330 missense probably benign 0.00
R7623:Pp2d1 UTSW 17 53515879 missense probably benign 0.00
R7712:Pp2d1 UTSW 17 53508290 missense possibly damaging 0.63
X0019:Pp2d1 UTSW 17 53515547 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CGTAGAAGTCTCGCCAACCTTATCAC -3'
(R):5'- TCACTTAGGCCAACATGGAACAATCAG -3'

Sequencing Primer
(F):5'- AATGCGTAGTTCACATTGTGAAGG -3'
(R):5'- cgcagtggtagacagagg -3'
Posted On2014-03-14