Incidental Mutation 'R1412:Tas2r135'
Institutional Source Beutler Lab
Gene Symbol Tas2r135
Ensembl Gene ENSMUSG00000056203
Gene Nametaste receptor, type 2, member 135
Synonymsmt2r38, Tas2r35
MMRRC Submission 039468-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1412 (G1)
Quality Score225
Status Validated
Chromosomal Location42405434-42406526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42405834 bp
Amino Acid Change Isoleucine to Methionine at position 102 (I102M)
Ref Sequence ENSEMBL: ENSMUSP00000070247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057398] [ENSMUST00000070178]
Predicted Effect probably benign
Transcript: ENSMUST00000057398
SMART Domains Protein: ENSMUSP00000057910
Gene: ENSMUSG00000046652

Pfam:TAS2R 1 293 6.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070178
AA Change: I102M

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203
AA Change: I102M

Pfam:TAS2R 22 320 1.3e-63 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,889,995 probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abca15 C T 7: 120,345,323 R394C possibly damaging Het
Adamts9 T C 6: 92,796,433 Q1152R probably benign Het
Adgrv1 C T 13: 81,095,450 G6277E probably damaging Het
Agbl2 A G 2: 90,788,954 N41S probably benign Het
Akap7 A T 10: 25,289,597 probably null Het
Arl6ip1 A G 7: 118,120,368 I179T possibly damaging Het
Atp1a4 C T 1: 172,232,009 D839N probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
C1qtnf12 T C 4: 155,962,733 V52A probably benign Het
C1qtnf2 A G 11: 43,491,132 Y257C probably damaging Het
Cdc123 A T 2: 5,803,965 D233E possibly damaging Het
Chdh G A 14: 30,034,723 E369K probably benign Het
D630045J12Rik A G 6: 38,195,760 V491A probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gabbr1 T C 17: 37,054,913 probably null Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Hs3st5 A T 10: 36,832,676 H69L probably benign Het
Igsf10 T C 3: 59,327,775 probably benign Het
Itga2b A T 11: 102,457,005 L890Q probably benign Het
Olfr675 A G 7: 105,024,195 F262L probably damaging Het
Olfr867 C G 9: 20,055,415 G16A possibly damaging Het
Parp10 A G 15: 76,243,084 L51P probably damaging Het
Pbld2 A G 10: 63,047,522 T108A probably damaging Het
Pdlim2 A T 14: 70,174,324 probably benign Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Pla2g12b G A 10: 59,403,982 probably null Het
Raly A G 2: 154,857,395 T40A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smim22 G C 16: 5,007,785 E11D possibly damaging Het
Socs2 T C 10: 95,414,918 S18G probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Tex19.2 A G 11: 121,116,935 V229A possibly damaging Het
Vmn1r234 T A 17: 21,229,250 I142N probably benign Het
Vwa3a C T 7: 120,780,154 T494I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfhx3 A G 8: 108,914,567 D1166G possibly damaging Het
Other mutations in Tas2r135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01357:Tas2r135 APN 6 42406144 missense probably benign 0.00
IGL01395:Tas2r135 APN 6 42405912 nonsense probably null
IGL02479:Tas2r135 APN 6 42405751 nonsense probably null
IGL02526:Tas2r135 APN 6 42406280 missense probably damaging 1.00
IGL02806:Tas2r135 APN 6 42406448 missense probably benign 0.00
IGL02982:Tas2r135 APN 6 42406253 missense probably benign
IGL03057:Tas2r135 APN 6 42401127 unclassified probably benign
R0057:Tas2r135 UTSW 6 42406420 missense probably benign 0.07
R0104:Tas2r135 UTSW 6 42406324 missense possibly damaging 0.79
R4517:Tas2r135 UTSW 6 42406079 missense probably benign
R4629:Tas2r135 UTSW 6 42406226 missense probably benign 0.03
R5788:Tas2r135 UTSW 6 42405597 missense probably damaging 1.00
R6021:Tas2r135 UTSW 6 42406387 missense probably damaging 1.00
R6586:Tas2r135 UTSW 6 42406018 missense probably benign 0.18
R7180:Tas2r135 UTSW 6 42405751 nonsense probably null
R7458:Tas2r135 UTSW 6 42405947 missense possibly damaging 0.95
R7850:Tas2r135 UTSW 6 42406138 missense probably benign
R7933:Tas2r135 UTSW 6 42406138 missense probably benign
Z1176:Tas2r135 UTSW 6 42406234 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-03-14