Incidental Mutation 'R1412:Olfr675'
ID 159632
Institutional Source Beutler Lab
Gene Symbol Olfr675
Ensembl Gene ENSMUSG00000096773
Gene Name olfactory receptor 675
Synonyms GA_x6K02T2PBJ9-7653782-7652841, MOR32-9P
MMRRC Submission 039468-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock # R1412 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 105021370-105028460 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105024195 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 262 (F262L)
Ref Sequence ENSEMBL: ENSMUSP00000149895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073102] [ENSMUST00000210113] [ENSMUST00000214318] [ENSMUST00000215899]
AlphaFold A0A1B0GSE1
Predicted Effect probably damaging
Transcript: ENSMUST00000073102
AA Change: F258L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072847
Gene: ENSMUSG00000096773
AA Change: F258L

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 5e-118 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.9e-6 PFAM
Pfam:7tm_1 43 293 2.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210113
AA Change: F262L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214318
AA Change: F262L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215899
AA Change: F262L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3030 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,889,995 probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Abca15 C T 7: 120,345,323 R394C possibly damaging Het
Adamts9 T C 6: 92,796,433 Q1152R probably benign Het
Adgrv1 C T 13: 81,095,450 G6277E probably damaging Het
Agbl2 A G 2: 90,788,954 N41S probably benign Het
Akap7 A T 10: 25,289,597 probably null Het
Arl6ip1 A G 7: 118,120,368 I179T possibly damaging Het
Atp1a4 C T 1: 172,232,009 D839N probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
C1qtnf12 T C 4: 155,962,733 V52A probably benign Het
C1qtnf2 A G 11: 43,491,132 Y257C probably damaging Het
Cdc123 A T 2: 5,803,965 D233E possibly damaging Het
Chdh G A 14: 30,034,723 E369K probably benign Het
D630045J12Rik A G 6: 38,195,760 V491A probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gabbr1 T C 17: 37,054,913 probably null Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Hs3st5 A T 10: 36,832,676 H69L probably benign Het
Igsf10 T C 3: 59,327,775 probably benign Het
Itga2b A T 11: 102,457,005 L890Q probably benign Het
Olfr867 C G 9: 20,055,415 G16A possibly damaging Het
Parp10 A G 15: 76,243,084 L51P probably damaging Het
Pbld2 A G 10: 63,047,522 T108A probably damaging Het
Pdlim2 A T 14: 70,174,324 probably benign Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Pla2g12b G A 10: 59,403,982 probably null Het
Raly A G 2: 154,857,395 T40A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smim22 G C 16: 5,007,785 E11D possibly damaging Het
Socs2 T C 10: 95,414,918 S18G probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Tas2r135 A G 6: 42,405,834 I102M probably benign Het
Tex19.2 A G 11: 121,116,935 V229A possibly damaging Het
Vmn1r234 T A 17: 21,229,250 I142N probably benign Het
Vwa3a C T 7: 120,780,154 T494I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfhx3 A G 8: 108,914,567 D1166G possibly damaging Het
Other mutations in Olfr675
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02639:Olfr675 APN 7 105024222 missense probably damaging 1.00
IGL02944:Olfr675 APN 7 105024923 missense probably damaging 1.00
R1182:Olfr675 UTSW 7 105024078 missense probably damaging 1.00
R1528:Olfr675 UTSW 7 105024764 missense probably damaging 1.00
R1555:Olfr675 UTSW 7 105024522 missense probably benign 0.00
R1589:Olfr675 UTSW 7 105024560 missense probably benign
R1778:Olfr675 UTSW 7 105024163 missense probably benign 0.03
R3690:Olfr675 UTSW 7 105024695 missense probably damaging 0.99
R3848:Olfr675 UTSW 7 105024332 missense probably damaging 0.99
R4784:Olfr675 UTSW 7 105024530 missense probably damaging 0.97
R5050:Olfr675 UTSW 7 105024387 missense probably damaging 1.00
R5074:Olfr675 UTSW 7 105024053 missense probably benign
R5499:Olfr675 UTSW 7 105024977 start codon destroyed probably null 0.06
R5586:Olfr675 UTSW 7 105024221 missense probably damaging 1.00
R7244:Olfr675 UTSW 7 105024941 missense probably benign
R8297:Olfr675 UTSW 7 105024678 missense probably benign 0.14
R8532:Olfr675 UTSW 7 105024566 missense probably damaging 1.00
R9087:Olfr675 UTSW 7 105024703 nonsense probably null
Z1176:Olfr675 UTSW 7 105024099 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACAAAATCCTCATTACTTGCTCCCG -3'
(R):5'- GCTACGTTGCCATTTGTAAGCCCC -3'

Sequencing Primer
(F):5'- GAATTTGCTTGGTCCTTACCC -3'
(R):5'- CTTACTGTGAACACATGGGC -3'
Posted On 2014-03-14