Incidental Mutation 'R1412:Abca15'
ID159635
Institutional Source Beutler Lab
Gene Symbol Abca15
Ensembl Gene ENSMUSG00000054746
Gene NameATP-binding cassette, sub-family A (ABC1), member 15
Synonyms4930500I12Rik
MMRRC Submission 039468-MU
Accession Numbers

NCBI RefSeq: NM_177213.3; MGI:2388709

Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1412 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location120328670-120407687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 120345323 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 394 (R394C)
Ref Sequence ENSEMBL: ENSMUSP00000112821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000121265]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076272
AA Change: R394C

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746
AA Change: R394C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000121265
AA Change: R394C

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746
AA Change: R394C

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140459
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
Allele List at MGI

All alleles(2) : Targeted(2

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,889,995 probably benign Het
9030624J02Rik A T 7: 118,809,971 I612F probably damaging Het
Adamts9 T C 6: 92,796,433 Q1152R probably benign Het
Adgrv1 C T 13: 81,095,450 G6277E probably damaging Het
Agbl2 A G 2: 90,788,954 N41S probably benign Het
Akap7 A T 10: 25,289,597 probably null Het
Arl6ip1 A G 7: 118,120,368 I179T possibly damaging Het
Atp1a4 C T 1: 172,232,009 D839N probably damaging Het
B3galt4 G A 17: 33,950,839 R142C probably damaging Het
C1qtnf12 T C 4: 155,962,733 V52A probably benign Het
C1qtnf2 A G 11: 43,491,132 Y257C probably damaging Het
Cdc123 A T 2: 5,803,965 D233E possibly damaging Het
Chdh G A 14: 30,034,723 E369K probably benign Het
D630045J12Rik A G 6: 38,195,760 V491A probably benign Het
Focad T C 4: 88,278,261 probably null Het
Gabbr1 T C 17: 37,054,913 probably null Het
Hat1 G T 2: 71,420,617 E170* probably null Het
Hs3st5 A T 10: 36,832,676 H69L probably benign Het
Igsf10 T C 3: 59,327,775 probably benign Het
Itga2b A T 11: 102,457,005 L890Q probably benign Het
Olfr675 A G 7: 105,024,195 F262L probably damaging Het
Olfr867 C G 9: 20,055,415 G16A possibly damaging Het
Parp10 A G 15: 76,243,084 L51P probably damaging Het
Pbld2 A G 10: 63,047,522 T108A probably damaging Het
Pdlim2 A T 14: 70,174,324 probably benign Het
Pikfyve T C 1: 65,202,830 V243A possibly damaging Het
Pla2g12b G A 10: 59,403,982 probably null Het
Raly A G 2: 154,857,395 T40A possibly damaging Het
Rasgrp3 G T 17: 75,509,827 probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Smim22 G C 16: 5,007,785 E11D possibly damaging Het
Socs2 T C 10: 95,414,918 S18G probably benign Het
Srgap2 T C 1: 131,300,413 E720G possibly damaging Het
Tas2r135 A G 6: 42,405,834 I102M probably benign Het
Tex19.2 A G 11: 121,116,935 V229A possibly damaging Het
Vmn1r234 T A 17: 21,229,250 I142N probably benign Het
Vwa3a C T 7: 120,780,154 T494I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Zfhx3 A G 8: 108,914,567 D1166G possibly damaging Het
Other mutations in Abca15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca15 APN 7 120397054 missense probably damaging 1.00
IGL00505:Abca15 APN 7 120369236 critical splice donor site probably null
IGL00851:Abca15 APN 7 120340007 missense probably damaging 1.00
IGL00985:Abca15 APN 7 120397018 missense probably damaging 1.00
IGL01114:Abca15 APN 7 120361420 missense probably damaging 0.99
IGL01287:Abca15 APN 7 120332858 utr 3 prime probably benign
IGL01333:Abca15 APN 7 120382308 missense probably damaging 1.00
IGL01482:Abca15 APN 7 120382746 missense probably benign 0.00
IGL01610:Abca15 APN 7 120340644 missense probably damaging 0.98
IGL02238:Abca15 APN 7 120396606 missense probably benign 0.02
IGL02377:Abca15 APN 7 120365910 splice site probably benign
IGL02666:Abca15 APN 7 120335208 missense probably damaging 1.00
IGL02836:Abca15 APN 7 120388216 missense probably benign
IGL03337:Abca15 APN 7 120396707 missense probably benign 0.24
IGL03354:Abca15 APN 7 120394488 nonsense probably null
H8562:Abca15 UTSW 7 120374854 splice site probably benign
IGL03098:Abca15 UTSW 7 120388276 splice site probably null
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0076:Abca15 UTSW 7 120373685 splice site probably benign
R0165:Abca15 UTSW 7 120350903 splice site probably benign
R0311:Abca15 UTSW 7 120402904 missense probably damaging 0.98
R0387:Abca15 UTSW 7 120332852 critical splice donor site probably null
R0610:Abca15 UTSW 7 120365786 missense possibly damaging 0.75
R0612:Abca15 UTSW 7 120337255 missense probably damaging 1.00
R0704:Abca15 UTSW 7 120354523 missense probably damaging 0.98
R0890:Abca15 UTSW 7 120373713 missense probably benign 0.01
R0961:Abca15 UTSW 7 120360985 nonsense probably null
R1144:Abca15 UTSW 7 120360860 splice site probably benign
R1419:Abca15 UTSW 7 120374902 missense probably benign 0.10
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1493:Abca15 UTSW 7 120382290 missense probably benign 0.00
R1513:Abca15 UTSW 7 120340099 missense probably damaging 0.96
R1702:Abca15 UTSW 7 120382702 missense probably benign 0.10
R1857:Abca15 UTSW 7 120361369 missense probably damaging 1.00
R1893:Abca15 UTSW 7 120340553 missense possibly damaging 0.85
R1901:Abca15 UTSW 7 120346099 missense probably damaging 1.00
R1951:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1953:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1962:Abca15 UTSW 7 120341245 missense probably damaging 1.00
R2063:Abca15 UTSW 7 120360904 missense possibly damaging 0.61
R2141:Abca15 UTSW 7 120407474 missense probably damaging 1.00
R2145:Abca15 UTSW 7 120354478 missense probably benign 0.08
R2182:Abca15 UTSW 7 120340227 nonsense probably null
R2425:Abca15 UTSW 7 120359810 missense probably damaging 1.00
R2444:Abca15 UTSW 7 120365897 missense probably damaging 1.00
R3023:Abca15 UTSW 7 120382779 missense probably benign 0.40
R3079:Abca15 UTSW 7 120385169 missense probably damaging 1.00
R3106:Abca15 UTSW 7 120396633 missense possibly damaging 0.63
R3622:Abca15 UTSW 7 120350813 nonsense probably null
R4085:Abca15 UTSW 7 120382726 missense probably damaging 1.00
R4233:Abca15 UTSW 7 120402979 nonsense probably null
R4591:Abca15 UTSW 7 120382413 missense probably damaging 1.00
R4612:Abca15 UTSW 7 120335161 missense probably benign 0.03
R4721:Abca15 UTSW 7 120350775 missense probably benign 0.01
R4838:Abca15 UTSW 7 120345300 missense probably benign 0.00
R4940:Abca15 UTSW 7 120332694 missense probably benign
R4963:Abca15 UTSW 7 120360919 missense probably damaging 1.00
R4993:Abca15 UTSW 7 120401718 missense probably damaging 0.99
R5022:Abca15 UTSW 7 120346096 missense probably damaging 0.98
R5030:Abca15 UTSW 7 120340001 missense probably damaging 1.00
R5072:Abca15 UTSW 7 120406975 missense probably damaging 1.00
R5090:Abca15 UTSW 7 120385199 missense probably damaging 1.00
R5309:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5310:Abca15 UTSW 7 120332616 missense possibly damaging 0.46
R5312:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5482:Abca15 UTSW 7 120369147 missense probably damaging 1.00
R5596:Abca15 UTSW 7 120401749 missense possibly damaging 0.94
R5853:Abca15 UTSW 7 120340583 missense probably benign 0.00
R5950:Abca15 UTSW 7 120382656 missense probably damaging 1.00
R5953:Abca15 UTSW 7 120361018 missense probably damaging 1.00
R6072:Abca15 UTSW 7 120388258 missense probably damaging 0.98
R6131:Abca15 UTSW 7 120340205 missense probably benign 0.03
R6132:Abca15 UTSW 7 120361420 missense probably benign 0.14
R6136:Abca15 UTSW 7 120340049 missense possibly damaging 0.81
R6207:Abca15 UTSW 7 120373794 missense probably benign 0.01
R6315:Abca15 UTSW 7 120346092 missense probably damaging 1.00
R6417:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6420:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6595:Abca15 UTSW 7 120394487 missense probably benign 0.00
R6653:Abca15 UTSW 7 120346006 missense probably benign 0.03
R6859:Abca15 UTSW 7 120402994 nonsense probably null
R6983:Abca15 UTSW 7 120354463 missense probably benign 0.26
R7127:Abca15 UTSW 7 120332602 missense probably benign 0.06
R7205:Abca15 UTSW 7 120394364 missense possibly damaging 0.89
R7336:Abca15 UTSW 7 120388233 missense possibly damaging 0.66
R7426:Abca15 UTSW 7 120345998 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ACACTGCGTTCTAGGTATGGCATTG -3'
(R):5'- TGGACTCCCAGAGAGATTGTGAGG -3'

Sequencing Primer
(F):5'- gggggaaacagtggtagac -3'
(R):5'- AGATTGTGAGGCCACTCATAC -3'
Posted On2014-03-14