Incidental Mutation 'R1412:Pdlim2'
ID 159648
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene Name PDZ and LIM domain 2
Synonyms SLIM, 4732462F18Rik, mystique
MMRRC Submission 039468-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R1412 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 70401667-70415130 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 70411773 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000143393] [ENSMUST00000153735]
AlphaFold Q8R1G6
Predicted Effect probably benign
Transcript: ENSMUST00000022681
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153735
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,867,359 (GRCm39) probably benign Het
Abca15 C T 7: 119,944,546 (GRCm39) R394C possibly damaging Het
Adamts9 T C 6: 92,773,414 (GRCm39) Q1152R probably benign Het
Adgrv1 C T 13: 81,243,569 (GRCm39) G6277E probably damaging Het
Agbl2 A G 2: 90,619,298 (GRCm39) N41S probably benign Het
Akap7 A T 10: 25,165,495 (GRCm39) probably null Het
Arl6ip1 A G 7: 117,719,591 (GRCm39) I179T possibly damaging Het
Atp1a4 C T 1: 172,059,576 (GRCm39) D839N probably damaging Het
B3galt4 G A 17: 34,169,813 (GRCm39) R142C probably damaging Het
C1qtnf12 T C 4: 156,047,190 (GRCm39) V52A probably benign Het
C1qtnf2 A G 11: 43,381,959 (GRCm39) Y257C probably damaging Het
Cdc123 A T 2: 5,808,776 (GRCm39) D233E possibly damaging Het
Chdh G A 14: 29,756,680 (GRCm39) E369K probably benign Het
D630045J12Rik A G 6: 38,172,695 (GRCm39) V491A probably benign Het
Focad T C 4: 88,196,498 (GRCm39) probably null Het
Gabbr1 T C 17: 37,365,805 (GRCm39) probably null Het
Hat1 G T 2: 71,250,961 (GRCm39) E170* probably null Het
Hs3st5 A T 10: 36,708,672 (GRCm39) H69L probably benign Het
Igsf10 T C 3: 59,235,196 (GRCm39) probably benign Het
Itga2b A T 11: 102,347,831 (GRCm39) L890Q probably benign Het
Or52e8b A G 7: 104,673,402 (GRCm39) F262L probably damaging Het
Or7d11 C G 9: 19,966,711 (GRCm39) G16A possibly damaging Het
Parp10 A G 15: 76,127,284 (GRCm39) L51P probably damaging Het
Pbld2 A G 10: 62,883,301 (GRCm39) T108A probably damaging Het
Pikfyve T C 1: 65,241,989 (GRCm39) V243A possibly damaging Het
Pla2g12b G A 10: 59,239,804 (GRCm39) probably null Het
Raly A G 2: 154,699,315 (GRCm39) T40A possibly damaging Het
Rasgrp3 G T 17: 75,816,822 (GRCm39) probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Smim22 G C 16: 4,825,649 (GRCm39) E11D possibly damaging Het
Socs2 T C 10: 95,250,780 (GRCm39) S18G probably benign Het
Srgap2 T C 1: 131,228,151 (GRCm39) E720G possibly damaging Het
Tas2r135 A G 6: 42,382,768 (GRCm39) I102M probably benign Het
Tex19.2 A G 11: 121,007,761 (GRCm39) V229A possibly damaging Het
Vmn1r234 T A 17: 21,449,512 (GRCm39) I142N probably benign Het
Vps35l A T 7: 118,409,194 (GRCm39) I612F probably damaging Het
Vwa3a C T 7: 120,379,377 (GRCm39) T494I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Zfhx3 A G 8: 109,641,199 (GRCm39) D1166G possibly damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70,403,532 (GRCm39) splice site probably benign
IGL02338:Pdlim2 APN 14 70,411,906 (GRCm39) missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70,411,925 (GRCm39) missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70,403,579 (GRCm39) missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1595:Pdlim2 UTSW 14 70,402,193 (GRCm39) missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70,408,688 (GRCm39) missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70,411,784 (GRCm39) critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70,403,549 (GRCm39) missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70,405,464 (GRCm39) unclassified probably benign
R4971:Pdlim2 UTSW 14 70,405,208 (GRCm39) missense probably damaging 1.00
R5951:Pdlim2 UTSW 14 70,405,229 (GRCm39) missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70,405,137 (GRCm39) missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70,411,826 (GRCm39) missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70,403,645 (GRCm39) missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70,408,924 (GRCm39) missense probably benign
R8342:Pdlim2 UTSW 14 70,403,563 (GRCm39) missense probably damaging 1.00
R8554:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign
R9361:Pdlim2 UTSW 14 70,402,190 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTACCATTCTCATGGCTGGGAAC -3'
(R):5'- GCCACTCAAGCCTGTAAGGGATTAG -3'

Sequencing Primer
(F):5'- TGGGAACCAGTCAAACCTG -3'
(R):5'- GTATTCAGCAGCCAGCATCTG -3'
Posted On 2014-03-14