Incidental Mutation 'R1412:B3galt4'
ID 159653
Institutional Source Beutler Lab
Gene Symbol B3galt4
Ensembl Gene ENSMUSG00000067370
Gene Name UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Synonyms Gal-T2
MMRRC Submission 039468-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R1412 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34168886-34170462 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 34169813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 142 (R142C)
Ref Sequence ENSEMBL: ENSMUSP00000084823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008812] [ENSMUST00000025170] [ENSMUST00000025178] [ENSMUST00000087543] [ENSMUST00000174609]
AlphaFold Q9Z0F0
Predicted Effect probably benign
Transcript: ENSMUST00000008812
SMART Domains Protein: ENSMUSP00000008812
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 142 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000025178
SMART Domains Protein: ENSMUSP00000025178
Gene: ENSMUSG00000024319

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
low complexity region 24 45 N/A INTRINSIC
Pfam:Sec3_C 79 244 4.6e-13 PFAM
Pfam:Vps52 94 601 5.1e-233 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000087543
AA Change: R142C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084823
Gene: ENSMUSG00000067370
AA Change: R142C

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Galactosyl_T 85 302 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174175
Predicted Effect probably benign
Transcript: ENSMUST00000174609
SMART Domains Protein: ENSMUSP00000138296
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 107 2.1e-21 PFAM
Meta Mutation Damage Score 0.4813 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is oriented telomere to centromere in close proximity to the ribosomal protein S18 gene. The functionality of the encoded protein is limited to ganglioseries glycolipid biosynthesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009A15Rik T C 19: 8,867,359 (GRCm39) probably benign Het
Abca15 C T 7: 119,944,546 (GRCm39) R394C possibly damaging Het
Adamts9 T C 6: 92,773,414 (GRCm39) Q1152R probably benign Het
Adgrv1 C T 13: 81,243,569 (GRCm39) G6277E probably damaging Het
Agbl2 A G 2: 90,619,298 (GRCm39) N41S probably benign Het
Akap7 A T 10: 25,165,495 (GRCm39) probably null Het
Arl6ip1 A G 7: 117,719,591 (GRCm39) I179T possibly damaging Het
Atp1a4 C T 1: 172,059,576 (GRCm39) D839N probably damaging Het
C1qtnf12 T C 4: 156,047,190 (GRCm39) V52A probably benign Het
C1qtnf2 A G 11: 43,381,959 (GRCm39) Y257C probably damaging Het
Cdc123 A T 2: 5,808,776 (GRCm39) D233E possibly damaging Het
Chdh G A 14: 29,756,680 (GRCm39) E369K probably benign Het
D630045J12Rik A G 6: 38,172,695 (GRCm39) V491A probably benign Het
Focad T C 4: 88,196,498 (GRCm39) probably null Het
Gabbr1 T C 17: 37,365,805 (GRCm39) probably null Het
Hat1 G T 2: 71,250,961 (GRCm39) E170* probably null Het
Hs3st5 A T 10: 36,708,672 (GRCm39) H69L probably benign Het
Igsf10 T C 3: 59,235,196 (GRCm39) probably benign Het
Itga2b A T 11: 102,347,831 (GRCm39) L890Q probably benign Het
Or52e8b A G 7: 104,673,402 (GRCm39) F262L probably damaging Het
Or7d11 C G 9: 19,966,711 (GRCm39) G16A possibly damaging Het
Parp10 A G 15: 76,127,284 (GRCm39) L51P probably damaging Het
Pbld2 A G 10: 62,883,301 (GRCm39) T108A probably damaging Het
Pdlim2 A T 14: 70,411,773 (GRCm39) probably benign Het
Pikfyve T C 1: 65,241,989 (GRCm39) V243A possibly damaging Het
Pla2g12b G A 10: 59,239,804 (GRCm39) probably null Het
Raly A G 2: 154,699,315 (GRCm39) T40A possibly damaging Het
Rasgrp3 G T 17: 75,816,822 (GRCm39) probably null Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,558,948 (GRCm39) probably benign Het
Smim22 G C 16: 4,825,649 (GRCm39) E11D possibly damaging Het
Socs2 T C 10: 95,250,780 (GRCm39) S18G probably benign Het
Srgap2 T C 1: 131,228,151 (GRCm39) E720G possibly damaging Het
Tas2r135 A G 6: 42,382,768 (GRCm39) I102M probably benign Het
Tex19.2 A G 11: 121,007,761 (GRCm39) V229A possibly damaging Het
Vmn1r234 T A 17: 21,449,512 (GRCm39) I142N probably benign Het
Vps35l A T 7: 118,409,194 (GRCm39) I612F probably damaging Het
Vwa3a C T 7: 120,379,377 (GRCm39) T494I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Zfhx3 A G 8: 109,641,199 (GRCm39) D1166G possibly damaging Het
Other mutations in B3galt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:B3galt4 APN 17 34,170,187 (GRCm39) missense probably benign 0.23
IGL02216:B3galt4 APN 17 34,169,539 (GRCm39) missense probably damaging 1.00
beacon UTSW 17 34,169,819 (GRCm39) missense probably damaging 1.00
beguiling UTSW 17 34,169,821 (GRCm39) missense probably damaging 1.00
R0326:B3galt4 UTSW 17 34,169,722 (GRCm39) missense probably damaging 1.00
R0419:B3galt4 UTSW 17 34,169,764 (GRCm39) missense probably damaging 1.00
R0446:B3galt4 UTSW 17 34,169,992 (GRCm39) missense probably benign 0.00
R1024:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R1028:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R1590:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R1591:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R1681:B3galt4 UTSW 17 34,170,187 (GRCm39) missense probably benign 0.23
R1851:B3galt4 UTSW 17 34,169,885 (GRCm39) missense probably benign 0.26
R1955:B3galt4 UTSW 17 34,169,606 (GRCm39) nonsense probably null
R2103:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R5802:B3galt4 UTSW 17 34,169,731 (GRCm39) missense probably damaging 1.00
R6922:B3galt4 UTSW 17 34,169,821 (GRCm39) missense probably damaging 1.00
R7644:B3galt4 UTSW 17 34,169,419 (GRCm39) missense probably damaging 0.99
R8073:B3galt4 UTSW 17 34,169,797 (GRCm39) missense probably damaging 1.00
R8687:B3galt4 UTSW 17 34,169,819 (GRCm39) missense probably damaging 1.00
R8839:B3galt4 UTSW 17 34,169,867 (GRCm39) missense possibly damaging 0.89
R9200:B3galt4 UTSW 17 34,170,384 (GRCm39) unclassified probably benign
Z1177:B3galt4 UTSW 17 34,170,110 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CCTGCCTAAATACAGAAGGGGCAC -3'
(R):5'- AGAGAAACGCCATTCGGGCATC -3'

Sequencing Primer
(F):5'- AGAAGGGGCACTGCCTG -3'
(R):5'- TCTTGGGGTGCCATCCG -3'
Posted On 2014-03-14