Incidental Mutation 'R1413:Tiprl'
ID 159663
Institutional Source Beutler Lab
Gene Symbol Tiprl
Ensembl Gene ENSMUSG00000040843
Gene Name TIP41, TOR signalling pathway regulator-like (S. cerevisiae)
Synonyms 1810011K17Rik
MMRRC Submission 039469-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1413 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 165039855-165064565 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 165043359 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 256 (E256K)
Ref Sequence ENSEMBL: ENSMUSP00000037514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043235] [ENSMUST00000192436]
AlphaFold Q8BH58
Predicted Effect possibly damaging
Transcript: ENSMUST00000043235
AA Change: E256K

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037514
Gene: ENSMUSG00000040843
AA Change: E256K

DomainStartEndE-ValueType
Pfam:TIP41 48 225 1.7e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192726
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TIPRL is an inhibitory regulator of protein phosphatase-2A (PP2A) (see PPP2CA; MIM 176915), PP4 (see PPP4C; MIM 602035), and PP6 (see PPP6C; MIM 612725) (McConnell et al., 2007 [PubMed 17384681]).[supplied by OMIM, Nov 2010]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,573,245 (GRCm39) N1051D possibly damaging Het
Abcc9 A G 6: 142,536,222 (GRCm39) V1504A probably damaging Het
Actr6 A T 10: 89,564,019 (GRCm39) Y84* probably null Het
Adgrl3 T C 5: 81,841,366 (GRCm39) Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,586 (GRCm39) probably benign Het
Amd1 A T 10: 40,166,404 (GRCm39) C157* probably null Het
Ank1 G A 8: 23,609,393 (GRCm39) E1362K probably damaging Het
Atp10b A G 11: 43,121,391 (GRCm39) Q1018R probably benign Het
Atp1a2 G A 1: 172,106,911 (GRCm39) T803I probably damaging Het
Atr T G 9: 95,814,495 (GRCm39) L2064R probably damaging Het
Bmp3 T A 5: 99,020,264 (GRCm39) L229Q probably damaging Het
Ccl25 A G 8: 4,403,892 (GRCm39) *54W probably null Het
Cdc45 A T 16: 18,627,491 (GRCm39) N111K possibly damaging Het
Cfap61 T A 2: 145,805,363 (GRCm39) S154T probably benign Het
Cyp2c37 T A 19: 39,982,542 (GRCm39) S127T probably benign Het
Cyp4f40 T A 17: 32,892,913 (GRCm39) D309E probably benign Het
D6Ertd527e A G 6: 87,088,335 (GRCm39) D166G unknown Het
Dmbt1 T A 7: 130,651,944 (GRCm39) D395E probably damaging Het
Dnah5 A G 15: 28,370,555 (GRCm39) S2832G probably benign Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Fah T C 7: 84,242,420 (GRCm39) D296G probably damaging Het
Fam83g A G 11: 61,593,504 (GRCm39) N346S probably damaging Het
Fgl1 T A 8: 41,644,638 (GRCm39) T289S possibly damaging Het
Fmo1 A C 1: 162,661,431 (GRCm39) L284R probably damaging Het
Frem3 T A 8: 81,395,430 (GRCm39) M1819K probably benign Het
Fsip2 T A 2: 82,818,762 (GRCm39) L4832M possibly damaging Het
Fut1 T C 7: 45,268,852 (GRCm39) W269R probably damaging Het
Ggnbp2 A G 11: 84,723,955 (GRCm39) Y638H probably damaging Het
Gp2 T A 7: 119,050,853 (GRCm39) I293F probably benign Het
Gpi1 T C 7: 33,929,580 (GRCm39) N20S probably benign Het
Gxylt1 C T 15: 93,152,273 (GRCm39) R222H probably damaging Het
Hemgn T C 4: 46,396,091 (GRCm39) K382E possibly damaging Het
Hook3 T A 8: 26,528,134 (GRCm39) E585D probably damaging Het
Irf6 G A 1: 192,851,613 (GRCm39) M401I probably benign Het
Jmjd1c A G 10: 67,085,529 (GRCm39) T2259A probably damaging Het
Lactb T A 9: 66,878,201 (GRCm39) R209S probably damaging Het
Lonp2 A G 8: 87,368,212 (GRCm39) D342G probably damaging Het
Mmachc T C 4: 116,563,194 (GRCm39) S54G probably damaging Het
Mpp7 C A 18: 7,350,977 (GRCm39) W573C probably damaging Het
Or13e8 T A 4: 43,697,011 (GRCm39) H54L possibly damaging Het
Or5w1b T A 2: 87,476,182 (GRCm39) Y95F probably benign Het
Or6b2b A T 1: 92,418,610 (GRCm39) I289N probably damaging Het
Pappa2 A T 1: 158,764,124 (GRCm39) D462E probably benign Het
Pcdh12 A T 18: 38,416,496 (GRCm39) F210I probably damaging Het
Ppp1r12c A G 7: 4,487,443 (GRCm39) probably null Het
Prkce T A 17: 86,803,446 (GRCm39) D448E possibly damaging Het
Ptprb C A 10: 116,175,584 (GRCm39) T1193K probably damaging Het
Qrfpr T A 3: 36,236,809 (GRCm39) E197D possibly damaging Het
Rusc2 T A 4: 43,416,568 (GRCm39) C625S probably benign Het
Shcbp1 T G 8: 4,791,968 (GRCm39) probably null Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spag5 T A 11: 78,196,143 (GRCm39) C449* probably null Het
Stpg3 T C 2: 25,103,862 (GRCm39) D158G probably damaging Het
Sycp2 T C 2: 177,989,590 (GRCm39) Y1423C probably benign Het
Tmem132c T A 5: 127,640,631 (GRCm39) V934D probably damaging Het
Topors A G 4: 40,261,982 (GRCm39) V434A probably benign Het
Usp11 A G X: 20,584,946 (GRCm39) Y731C probably damaging Het
Vmn2r58 T A 7: 41,513,387 (GRCm39) I419L probably benign Het
Wfs1 C A 5: 37,139,422 (GRCm39) R72L possibly damaging Het
Zan T C 5: 137,426,201 (GRCm39) D2525G unknown Het
Zfp280c A G X: 47,652,715 (GRCm39) V285A probably benign Het
Zfp511 T A 7: 139,617,528 (GRCm39) F177I probably damaging Het
Zfp964 A G 8: 70,115,720 (GRCm39) M107V unknown Het
Zmynd11 A G 13: 9,760,256 (GRCm39) Y122H probably damaging Het
Other mutations in Tiprl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02970:Tiprl APN 1 165,064,315 (GRCm39) missense probably damaging 1.00
3-1:Tiprl UTSW 1 165,043,397 (GRCm39) missense possibly damaging 0.80
R0471:Tiprl UTSW 1 165,050,092 (GRCm39) splice site probably null
R0647:Tiprl UTSW 1 165,050,092 (GRCm39) splice site probably null
R1536:Tiprl UTSW 1 165,055,975 (GRCm39) missense probably benign 0.00
R4232:Tiprl UTSW 1 165,050,156 (GRCm39) missense probably damaging 0.99
R4997:Tiprl UTSW 1 165,047,759 (GRCm39) missense possibly damaging 0.53
R5238:Tiprl UTSW 1 165,043,337 (GRCm39) missense probably benign
R7972:Tiprl UTSW 1 165,064,543 (GRCm39) unclassified probably benign
R8114:Tiprl UTSW 1 165,055,991 (GRCm39) missense probably benign 0.13
R9683:Tiprl UTSW 1 165,050,147 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACGTAAGCTCCAGAGCACATC -3'
(R):5'- TCAGCCACACAGTTGAACGATTGAG -3'

Sequencing Primer
(F):5'- CAGAGCACATCTCTCTCTGG -3'
(R):5'- TGTCCCCAGGGCTGAAATTAG -3'
Posted On 2014-03-14