Incidental Mutation 'R1413:Sycp2'
ID159671
Institutional Source Beutler Lab
Gene Symbol Sycp2
Ensembl Gene ENSMUSG00000060445
Gene Namesynaptonemal complex protein 2
Synonyms3830402K23Rik, 4930518F03Rik
MMRRC Submission 039469-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1413 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location178345293-178407685 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 178347797 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1423 (Y1423C)
Ref Sequence ENSEMBL: ENSMUSP00000079909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081134]
Predicted Effect probably benign
Transcript: ENSMUST00000081134
AA Change: Y1423C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000079909
Gene: ENSMUSG00000060445
AA Change: Y1423C

DomainStartEndE-ValueType
low complexity region 945 960 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1076 1091 N/A INTRINSIC
low complexity region 1195 1204 N/A INTRINSIC
low complexity region 1273 1293 N/A INTRINSIC
low complexity region 1355 1364 N/A INTRINSIC
coiled coil region 1387 1429 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132611
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptonemal complex is a proteinaceous structure that links homologous chromosomes during the prophase of meiosis. The protein encoded by this gene is a major component of the synaptonemal complex and may bind DNA at scaffold attachment regions. The encoded protein requires synaptonemal complex protein 3, but not 1, for inclusion in the synaptonemal complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele are sterile due to lack of axial element formation and subsequent failure of chromosome synapsis in prophase I spermatocytes, while females are subfertile with a sharply reduced litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,590,496 V1504A probably damaging Het
Abcc9 T C 6: 142,627,519 N1051D possibly damaging Het
Actr6 A T 10: 89,728,157 Y84* probably null Het
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,587 probably benign Het
Amd1 A T 10: 40,290,408 C157* probably null Het
Ank1 G A 8: 23,119,377 E1362K probably damaging Het
Atp10b A G 11: 43,230,564 Q1018R probably benign Het
Atp1a2 G A 1: 172,279,344 T803I probably damaging Het
Atr T G 9: 95,932,442 L2064R probably damaging Het
Bmp3 T A 5: 98,872,405 L229Q probably damaging Het
Ccl25 A G 8: 4,353,892 *54W probably null Het
Cdc45 A T 16: 18,808,741 N111K possibly damaging Het
Cfap61 T A 2: 145,963,443 S154T probably benign Het
Cyp2c37 T A 19: 39,994,098 S127T probably benign Het
Cyp4f40 T A 17: 32,673,939 D309E probably benign Het
D6Ertd527e A G 6: 87,111,353 D166G unknown Het
Dmbt1 T A 7: 131,050,214 D395E probably damaging Het
Dnah5 A G 15: 28,370,409 S2832G probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fah T C 7: 84,593,212 D296G probably damaging Het
Fam83g A G 11: 61,702,678 N346S probably damaging Het
Fgl1 T A 8: 41,191,601 T289S possibly damaging Het
Fmo1 A C 1: 162,833,862 L284R probably damaging Het
Frem3 T A 8: 80,668,801 M1819K probably benign Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Fut1 T C 7: 45,619,428 W269R probably damaging Het
Ggnbp2 A G 11: 84,833,129 Y638H probably damaging Het
Gp2 T A 7: 119,451,630 I293F probably benign Het
Gpi1 T C 7: 34,230,155 N20S probably benign Het
Gxylt1 C T 15: 93,254,392 R222H probably damaging Het
Hemgn T C 4: 46,396,091 K382E possibly damaging Het
Hook3 T A 8: 26,038,106 E585D probably damaging Het
Irf6 G A 1: 193,169,305 M401I probably benign Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Lactb T A 9: 66,970,919 R209S probably damaging Het
Lonp2 A G 8: 86,641,584 D342G probably damaging Het
Mmachc T C 4: 116,705,997 S54G probably damaging Het
Mpp7 C A 18: 7,350,977 W573C probably damaging Het
Olfr1133 T A 2: 87,645,838 Y95F probably benign Het
Olfr1415 A T 1: 92,490,888 I289N probably damaging Het
Olfr70 T A 4: 43,697,011 H54L possibly damaging Het
Pappa2 A T 1: 158,936,554 D462E probably benign Het
Pcdh12 A T 18: 38,283,443 F210I probably damaging Het
Ppp1r12c A G 7: 4,484,444 probably null Het
Prkce T A 17: 86,496,018 D448E possibly damaging Het
Ptprb C A 10: 116,339,679 T1193K probably damaging Het
Qrfpr T A 3: 36,182,660 E197D possibly damaging Het
Rusc2 T A 4: 43,416,568 C625S probably benign Het
Shcbp1 T G 8: 4,741,968 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spag5 T A 11: 78,305,317 C449* probably null Het
Stpg3 T C 2: 25,213,850 D158G probably damaging Het
Tiprl C T 1: 165,215,790 E256K possibly damaging Het
Tmem132c T A 5: 127,563,567 V934D probably damaging Het
Topors A G 4: 40,261,982 V434A probably benign Het
Usp11 A G X: 20,718,707 Y731C probably damaging Het
Vmn2r58 T A 7: 41,863,963 I419L probably benign Het
Wfs1 C A 5: 36,982,078 R72L possibly damaging Het
Zan T C 5: 137,427,939 D2525G unknown Het
Zfp280c A G X: 48,563,838 V285A probably benign Het
Zfp511 T A 7: 140,037,615 F177I probably damaging Het
Zfp964 A G 8: 69,663,070 M107V unknown Het
Zmynd11 A G 13: 9,710,220 Y122H probably damaging Het
Other mutations in Sycp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Sycp2 APN 2 178382348 missense probably damaging 1.00
IGL00578:Sycp2 APN 2 178350822 splice site probably benign
IGL00646:Sycp2 APN 2 178374459 missense probably benign 0.00
IGL01309:Sycp2 APN 2 178358111 missense probably benign 0.15
IGL01464:Sycp2 APN 2 178401632 missense probably damaging 0.96
IGL01539:Sycp2 APN 2 178374695 missense probably damaging 1.00
IGL01670:Sycp2 APN 2 178378050 missense probably benign 0.00
IGL02138:Sycp2 APN 2 178401990 nonsense probably null
IGL02138:Sycp2 APN 2 178358254 missense probably benign 0.31
IGL02630:Sycp2 APN 2 178401919 missense probably damaging 1.00
IGL02673:Sycp2 APN 2 178394211 missense possibly damaging 0.63
IGL02961:Sycp2 APN 2 178380862 missense probably benign 0.01
IGL03084:Sycp2 APN 2 178391791 unclassified probably benign
IGL03123:Sycp2 APN 2 178352479 nonsense probably null
IGL03167:Sycp2 APN 2 178379498 missense probably damaging 0.99
R0043:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0050:Sycp2 UTSW 2 178364711 missense probably damaging 1.00
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0096:Sycp2 UTSW 2 178403735 missense probably damaging 0.99
R0310:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0363:Sycp2 UTSW 2 178346411 splice site probably benign
R0456:Sycp2 UTSW 2 178381855 missense probably benign 0.44
R0597:Sycp2 UTSW 2 178356580 missense possibly damaging 0.54
R0608:Sycp2 UTSW 2 178382404 missense probably damaging 0.98
R1112:Sycp2 UTSW 2 178352536 missense probably benign 0.05
R1127:Sycp2 UTSW 2 178374366 missense possibly damaging 0.72
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1208:Sycp2 UTSW 2 178356628 missense possibly damaging 0.92
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1323:Sycp2 UTSW 2 178347621 missense possibly damaging 0.50
R1557:Sycp2 UTSW 2 178395216 unclassified probably benign
R1562:Sycp2 UTSW 2 178382385 missense probably damaging 1.00
R1585:Sycp2 UTSW 2 178351668 missense possibly damaging 0.50
R1932:Sycp2 UTSW 2 178381957 missense probably damaging 1.00
R1950:Sycp2 UTSW 2 178402800 missense probably benign 0.00
R2001:Sycp2 UTSW 2 178378055 missense probably benign 0.05
R2105:Sycp2 UTSW 2 178350138 splice site probably null
R2382:Sycp2 UTSW 2 178378018 critical splice donor site probably null
R2403:Sycp2 UTSW 2 178403735 nonsense probably null
R2483:Sycp2 UTSW 2 178374595 missense probably damaging 0.98
R3003:Sycp2 UTSW 2 178358123 missense probably benign 0.01
R3418:Sycp2 UTSW 2 178401653 splice site probably benign
R3686:Sycp2 UTSW 2 178374384 missense probably benign 0.16
R4038:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4039:Sycp2 UTSW 2 178380927 missense possibly damaging 0.72
R4272:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R4343:Sycp2 UTSW 2 178380947 missense probably damaging 0.99
R4491:Sycp2 UTSW 2 178374985 missense probably damaging 1.00
R4534:Sycp2 UTSW 2 178355009 missense probably damaging 1.00
R4720:Sycp2 UTSW 2 178374432 missense probably benign 0.11
R4805:Sycp2 UTSW 2 178393961 unclassified probably benign
R4807:Sycp2 UTSW 2 178393961 unclassified probably benign
R4808:Sycp2 UTSW 2 178393961 unclassified probably benign
R4906:Sycp2 UTSW 2 178403657 critical splice donor site probably null
R4910:Sycp2 UTSW 2 178358224 missense probably benign 0.04
R5282:Sycp2 UTSW 2 178403761 missense probably damaging 1.00
R5285:Sycp2 UTSW 2 178392398 splice site probably null
R5316:Sycp2 UTSW 2 178356503 missense probably benign 0.00
R5389:Sycp2 UTSW 2 178377702 splice site probably null
R5621:Sycp2 UTSW 2 178381918 missense probably benign 0.05
R5652:Sycp2 UTSW 2 178358705 splice site probably null
R5880:Sycp2 UTSW 2 178374470 missense possibly damaging 0.92
R6114:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6115:Sycp2 UTSW 2 178348245 missense probably benign 0.25
R6186:Sycp2 UTSW 2 178383560 missense probably damaging 0.97
R6351:Sycp2 UTSW 2 178363416 missense probably damaging 1.00
R6509:Sycp2 UTSW 2 178395894 missense probably damaging 1.00
R6536:Sycp2 UTSW 2 178351648 missense probably damaging 1.00
R6679:Sycp2 UTSW 2 178380928 missense probably damaging 0.96
R6687:Sycp2 UTSW 2 178354960 missense probably damaging 0.99
R6761:Sycp2 UTSW 2 178374351 splice site probably null
R6786:Sycp2 UTSW 2 178383552 missense possibly damaging 0.63
R7357:Sycp2 UTSW 2 178403804 splice site probably null
R7422:Sycp2 UTSW 2 178394151 missense probably damaging 1.00
R7519:Sycp2 UTSW 2 178346333 makesense probably null
R7805:Sycp2 UTSW 2 178380858 missense probably damaging 0.99
R8022:Sycp2 UTSW 2 178355062 missense probably damaging 1.00
R8037:Sycp2 UTSW 2 178403778 missense probably damaging 1.00
R8038:Sycp2 UTSW 2 178403778 missense probably damaging 1.00
R8039:Sycp2 UTSW 2 178374585 missense probably benign 0.05
Z1088:Sycp2 UTSW 2 178374367 missense probably benign
Z1088:Sycp2 UTSW 2 178381934 missense probably benign 0.17
Z1176:Sycp2 UTSW 2 178364881 missense probably damaging 1.00
Z1177:Sycp2 UTSW 2 178380875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGTGAAGTTTTCAAAACACGAAACC -3'
(R):5'- GCTGCAAATGAACTCTGAAATTGCCC -3'

Sequencing Primer
(F):5'- CTGTCCACATTCCACTGCTA -3'
(R):5'- TGAACTCTGAAATTGCCCACAAG -3'
Posted On2014-03-14