Incidental Mutation 'R1413:Fut1'
ID159692
Institutional Source Beutler Lab
Gene Symbol Fut1
Ensembl Gene ENSMUSG00000008461
Gene Namefucosyltransferase 1
SynonymsH transferase
MMRRC Submission 039469-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1413 (G1)
Quality Score202
Status Not validated
Chromosome7
Chromosomal Location45617289-45621059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45619428 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 269 (W269R)
Ref Sequence ENSEMBL: ENSMUSP00000008605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008605] [ENSMUST00000033099] [ENSMUST00000033100] [ENSMUST00000209379] [ENSMUST00000210150]
Predicted Effect probably damaging
Transcript: ENSMUST00000008605
AA Change: W269R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000008605
Gene: ENSMUSG00000008461
AA Change: W269R

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Glyco_transf_11 39 355 3.1e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033099
SMART Domains Protein: ENSMUSP00000033099
Gene: ENSMUSG00000030827

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FGF 44 169 3.95e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033100
SMART Domains Protein: ENSMUSP00000033100
Gene: ENSMUSG00000064158

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
Pfam:IZUMO 21 166 2.6e-53 PFAM
IG 167 253 2.43e-2 SMART
transmembrane domain 320 342 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209379
AA Change: W214R

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209590
Predicted Effect probably benign
Transcript: ENSMUST00000210150
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygous null mice are viable and healthy, lack alpha(1,2)fucose residues from the apical surface of pancreatic acinar glands and are deficient in epididymal cell surface alpha(1,2)fucosylated glycans but show normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,590,496 V1504A probably damaging Het
Abcc9 T C 6: 142,627,519 N1051D possibly damaging Het
Actr6 A T 10: 89,728,157 Y84* probably null Het
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,587 probably benign Het
Amd1 A T 10: 40,290,408 C157* probably null Het
Ank1 G A 8: 23,119,377 E1362K probably damaging Het
Atp10b A G 11: 43,230,564 Q1018R probably benign Het
Atp1a2 G A 1: 172,279,344 T803I probably damaging Het
Atr T G 9: 95,932,442 L2064R probably damaging Het
Bmp3 T A 5: 98,872,405 L229Q probably damaging Het
Ccl25 A G 8: 4,353,892 *54W probably null Het
Cdc45 A T 16: 18,808,741 N111K possibly damaging Het
Cfap61 T A 2: 145,963,443 S154T probably benign Het
Cyp2c37 T A 19: 39,994,098 S127T probably benign Het
Cyp4f40 T A 17: 32,673,939 D309E probably benign Het
D6Ertd527e A G 6: 87,111,353 D166G unknown Het
Dmbt1 T A 7: 131,050,214 D395E probably damaging Het
Dnah5 A G 15: 28,370,409 S2832G probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fah T C 7: 84,593,212 D296G probably damaging Het
Fam83g A G 11: 61,702,678 N346S probably damaging Het
Fgl1 T A 8: 41,191,601 T289S possibly damaging Het
Fmo1 A C 1: 162,833,862 L284R probably damaging Het
Frem3 T A 8: 80,668,801 M1819K probably benign Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Ggnbp2 A G 11: 84,833,129 Y638H probably damaging Het
Gp2 T A 7: 119,451,630 I293F probably benign Het
Gpi1 T C 7: 34,230,155 N20S probably benign Het
Gxylt1 C T 15: 93,254,392 R222H probably damaging Het
Hemgn T C 4: 46,396,091 K382E possibly damaging Het
Hook3 T A 8: 26,038,106 E585D probably damaging Het
Irf6 G A 1: 193,169,305 M401I probably benign Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Lactb T A 9: 66,970,919 R209S probably damaging Het
Lonp2 A G 8: 86,641,584 D342G probably damaging Het
Mmachc T C 4: 116,705,997 S54G probably damaging Het
Mpp7 C A 18: 7,350,977 W573C probably damaging Het
Olfr1133 T A 2: 87,645,838 Y95F probably benign Het
Olfr1415 A T 1: 92,490,888 I289N probably damaging Het
Olfr70 T A 4: 43,697,011 H54L possibly damaging Het
Pappa2 A T 1: 158,936,554 D462E probably benign Het
Pcdh12 A T 18: 38,283,443 F210I probably damaging Het
Ppp1r12c A G 7: 4,484,444 probably null Het
Prkce T A 17: 86,496,018 D448E possibly damaging Het
Ptprb C A 10: 116,339,679 T1193K probably damaging Het
Qrfpr T A 3: 36,182,660 E197D possibly damaging Het
Rusc2 T A 4: 43,416,568 C625S probably benign Het
Shcbp1 T G 8: 4,741,968 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spag5 T A 11: 78,305,317 C449* probably null Het
Stpg3 T C 2: 25,213,850 D158G probably damaging Het
Sycp2 T C 2: 178,347,797 Y1423C probably benign Het
Tiprl C T 1: 165,215,790 E256K possibly damaging Het
Tmem132c T A 5: 127,563,567 V934D probably damaging Het
Topors A G 4: 40,261,982 V434A probably benign Het
Usp11 A G X: 20,718,707 Y731C probably damaging Het
Vmn2r58 T A 7: 41,863,963 I419L probably benign Het
Wfs1 C A 5: 36,982,078 R72L possibly damaging Het
Zan T C 5: 137,427,939 D2525G unknown Het
Zfp280c A G X: 48,563,838 V285A probably benign Het
Zfp511 T A 7: 140,037,615 F177I probably damaging Het
Zfp964 A G 8: 69,663,070 M107V unknown Het
Zmynd11 A G 13: 9,710,220 Y122H probably damaging Het
Other mutations in Fut1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Fut1 APN 7 45619431 missense probably damaging 1.00
IGL02015:Fut1 APN 7 45618975 missense probably damaging 0.98
IGL02232:Fut1 APN 7 45619447 missense probably damaging 1.00
IGL02934:Fut1 APN 7 45618703 missense possibly damaging 0.49
IGL02976:Fut1 APN 7 45619320 missense probably damaging 1.00
IGL03091:Fut1 APN 7 45619527 missense probably damaging 1.00
IGL03169:Fut1 APN 7 45619033 missense probably benign 0.05
R0107:Fut1 UTSW 7 45618846 missense possibly damaging 0.50
R0107:Fut1 UTSW 7 45618846 missense possibly damaging 0.50
R2039:Fut1 UTSW 7 45618991 missense possibly damaging 0.62
R2403:Fut1 UTSW 7 45619219 missense probably benign 0.14
R2516:Fut1 UTSW 7 45619198 missense probably benign 0.03
R3429:Fut1 UTSW 7 45619374 missense probably damaging 1.00
R3430:Fut1 UTSW 7 45619374 missense probably damaging 1.00
R5775:Fut1 UTSW 7 45619462 missense probably damaging 1.00
R6244:Fut1 UTSW 7 45619306 missense possibly damaging 0.79
R6961:Fut1 UTSW 7 45619539 missense probably damaging 0.99
R7052:Fut1 UTSW 7 45619757 makesense probably null
R8027:Fut1 UTSW 7 45618865 missense probably damaging 1.00
Z1177:Fut1 UTSW 7 45619229 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATCTTCGGGAACAGATTCGTAGGG -3'
(R):5'- TGTCTCCACCAGCTAAGTAGGCAG -3'

Sequencing Primer
(F):5'- CGTAGGGAATTCACTCTGCATAAC -3'
(R):5'- CAGCTAAGTAGGCAGCCCAG -3'
Posted On2014-03-14