Mutagenetix > Incidental Mutation

Incidental Mutation 'R1413:Lonp2'

159705

Institutional Source

Beutler Lab

Gene Symbol

Lonp2

Ensembl Gene

ENSMUSG00000047866

Gene Name

lon peptidase 2, peroxisomal

Synonyms

1300002A08Rik

MMRRC Submission

039469-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.255) question?

Stock #

R1413 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86624043-86723873 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86641584 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 342 (D342G)

Ref Sequence

ENSEMBL: ENSMUSP00000118737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034141] [ENSMUST00000122188] [ENSMUST00000155433]

AlphaFold

Q9DBN5

Predicted Effect

probably damaging
Transcript: ENSMUST00000034141
AA Change: D342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034141
Gene: ENSMUSG00000047866
AA Change: D342G

Domain	Start	End	E-Value	Type
Pfam:LON_substr_bdg	12	220	1e-24	PFAM
low complexity region	243	255	N/A	INTRINSIC
low complexity region	259	269	N/A	INTRINSIC
AAA	367	512	1.59e-10	SMART
low complexity region	538	545	N/A	INTRINSIC
Pfam:Lon_C	628	837	1.6e-83	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000122188
AA Change: D200G

SMART Domains

Protein: ENSMUSP00000113834
Gene: ENSMUSG00000047866
AA Change: D200G

Domain	Start	End	E-Value	Type
Pfam:LON	12	224	9e-17	PFAM
AAA	225	370	1.59e-10	SMART
low complexity region	396	403	N/A	INTRINSIC
Pfam:Lon_C	486	695	1.5e-83	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124911

Predicted Effect

probably damaging
Transcript: ENSMUST00000155433
AA Change: D342G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118737
Gene: ENSMUSG00000047866
AA Change: D342G

Domain	Start	End	E-Value	Type
Pfam:LON	12	220	3.3e-26	PFAM
low complexity region	243	255	N/A	INTRINSIC
low complexity region	259	269	N/A	INTRINSIC
AAA	367	512	1.59e-10	SMART
low complexity region	538	545	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155501

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In human, peroxisomes function primarily to catalyze fatty acid beta-oxidation and, as a by-product, produce hydrogen peroxide and superoxide. The protein encoded by this gene is an ATP-dependent protease that likely plays a role in maintaining overall peroxisome homeostasis as well as proteolytically degrading peroxisomal proteins damaged by oxidation. The protein has an N-terminal Lon N substrate recognition domain, an ATPase domain, a proteolytic domain, and, in some isoforms, a C-terminal peroxisome targeting sequence. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,590,496	V1504A	probably damaging	Het
Abcc9	T	C	6: 142,627,519	N1051D	possibly damaging	Het
Actr6	A	T	10: 89,728,157	Y84*	probably null	Het
Adgrl3	T	C	5: 81,693,519	Y816H	probably damaging	Het
Ahcyl2	T	C	6: 29,768,587		probably benign	Het
Amd1	A	T	10: 40,290,408	C157*	probably null	Het
Ank1	G	A	8: 23,119,377	E1362K	probably damaging	Het
Atp10b	A	G	11: 43,230,564	Q1018R	probably benign	Het
Atp1a2	G	A	1: 172,279,344	T803I	probably damaging	Het
Atr	T	G	9: 95,932,442	L2064R	probably damaging	Het
Bmp3	T	A	5: 98,872,405	L229Q	probably damaging	Het
Ccl25	A	G	8: 4,353,892	*54W	probably null	Het
Cdc45	A	T	16: 18,808,741	N111K	possibly damaging	Het
Cfap61	T	A	2: 145,963,443	S154T	probably benign	Het
Cyp2c37	T	A	19: 39,994,098	S127T	probably benign	Het
Cyp4f40	T	A	17: 32,673,939	D309E	probably benign	Het
D6Ertd527e	A	G	6: 87,111,353	D166G	unknown	Het
Dmbt1	T	A	7: 131,050,214	D395E	probably damaging	Het
Dnah5	A	G	15: 28,370,409	S2832G	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Fah	T	C	7: 84,593,212	D296G	probably damaging	Het
Fam83g	A	G	11: 61,702,678	N346S	probably damaging	Het
Fgl1	T	A	8: 41,191,601	T289S	possibly damaging	Het
Fmo1	A	C	1: 162,833,862	L284R	probably damaging	Het
Frem3	T	A	8: 80,668,801	M1819K	probably benign	Het
Fsip2	T	A	2: 82,988,418	L4832M	possibly damaging	Het
Fut1	T	C	7: 45,619,428	W269R	probably damaging	Het
Ggnbp2	A	G	11: 84,833,129	Y638H	probably damaging	Het
Gp2	T	A	7: 119,451,630	I293F	probably benign	Het
Gpi1	T	C	7: 34,230,155	N20S	probably benign	Het
Gxylt1	C	T	15: 93,254,392	R222H	probably damaging	Het
Hemgn	T	C	4: 46,396,091	K382E	possibly damaging	Het
Hook3	T	A	8: 26,038,106	E585D	probably damaging	Het
Irf6	G	A	1: 193,169,305	M401I	probably benign	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Lactb	T	A	9: 66,970,919	R209S	probably damaging	Het
Mmachc	T	C	4: 116,705,997	S54G	probably damaging	Het
Mpp7	C	A	18: 7,350,977	W573C	probably damaging	Het
Olfr1133	T	A	2: 87,645,838	Y95F	probably benign	Het
Olfr1415	A	T	1: 92,490,888	I289N	probably damaging	Het
Olfr70	T	A	4: 43,697,011	H54L	possibly damaging	Het
Pappa2	A	T	1: 158,936,554	D462E	probably benign	Het
Pcdh12	A	T	18: 38,283,443	F210I	probably damaging	Het
Ppp1r12c	A	G	7: 4,484,444		probably null	Het
Prkce	T	A	17: 86,496,018	D448E	possibly damaging	Het
Ptprb	C	A	10: 116,339,679	T1193K	probably damaging	Het
Qrfpr	T	A	3: 36,182,660	E197D	possibly damaging	Het
Rusc2	T	A	4: 43,416,568	C625S	probably benign	Het
Shcbp1	T	G	8: 4,741,968		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spag5	T	A	11: 78,305,317	C449*	probably null	Het
Stpg3	T	C	2: 25,213,850	D158G	probably damaging	Het
Sycp2	T	C	2: 178,347,797	Y1423C	probably benign	Het
Tiprl	C	T	1: 165,215,790	E256K	possibly damaging	Het
Tmem132c	T	A	5: 127,563,567	V934D	probably damaging	Het
Topors	A	G	4: 40,261,982	V434A	probably benign	Het
Usp11	A	G	X: 20,718,707	Y731C	probably damaging	Het
Vmn2r58	T	A	7: 41,863,963	I419L	probably benign	Het
Wfs1	C	A	5: 36,982,078	R72L	possibly damaging	Het
Zan	T	C	5: 137,427,939	D2525G	unknown	Het
Zfp280c	A	G	X: 48,563,838	V285A	probably benign	Het
Zfp511	T	A	7: 140,037,615	F177I	probably damaging	Het
Zfp964	A	G	8: 69,663,070	M107V	unknown	Het
Zmynd11	A	G	13: 9,710,220	Y122H	probably damaging	Het

Other mutations in Lonp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Lonp2	APN	8	86633972	missense	probably damaging	1.00
IGL00990:Lonp2	APN	8	86641533	splice site	probably benign
IGL01654:Lonp2	APN	8	86714086	missense	probably damaging	1.00
IGL02021:Lonp2	APN	8	86708971	missense	probably benign	0.00
IGL02165:Lonp2	APN	8	86709026	missense	probably damaging	1.00
IGL02309:Lonp2	APN	8	86634863	missense	probably damaging	1.00
IGL02355:Lonp2	APN	8	86624246	missense	probably benign	0.17
IGL02362:Lonp2	APN	8	86624246	missense	probably benign	0.17
IGL02365:Lonp2	APN	8	86716365	missense	possibly damaging	0.69
IGL02374:Lonp2	APN	8	86709045	missense	probably damaging	0.97
IGL02440:Lonp2	APN	8	86624185	start codon destroyed	probably null	0.98
Furcht	UTSW	8	86631502	missense	probably benign	0.09
Horror	UTSW	8	86624248	missense	probably damaging	1.00
Shellshock	UTSW	8	86709013	missense	probably damaging	1.00
R0083:Lonp2	UTSW	8	86716355	missense	probably benign	0.13
R0108:Lonp2	UTSW	8	86716355	missense	probably benign	0.13
R0108:Lonp2	UTSW	8	86716355	missense	probably benign	0.13
R0129:Lonp2	UTSW	8	86634890	missense	probably damaging	0.99
R0302:Lonp2	UTSW	8	86637991	missense	possibly damaging	0.94
R0433:Lonp2	UTSW	8	86633954	missense	probably damaging	1.00
R1148:Lonp2	UTSW	8	86636540	missense	probably benign	0.00
R1148:Lonp2	UTSW	8	86636540	missense	probably benign	0.00
R1589:Lonp2	UTSW	8	86673072	splice site	probably benign
R1635:Lonp2	UTSW	8	86713450	missense	possibly damaging	0.78
R1654:Lonp2	UTSW	8	86631450	missense	probably damaging	0.99
R2033:Lonp2	UTSW	8	86708942	missense	possibly damaging	0.77
R2062:Lonp2	UTSW	8	86665775	missense	probably damaging	0.99
R2065:Lonp2	UTSW	8	86665775	missense	probably damaging	0.99
R2066:Lonp2	UTSW	8	86665775	missense	probably damaging	0.99
R2068:Lonp2	UTSW	8	86665775	missense	probably damaging	0.99
R4321:Lonp2	UTSW	8	86665728	missense	probably damaging	1.00
R4713:Lonp2	UTSW	8	86713315	missense	probably damaging	0.98
R4750:Lonp2	UTSW	8	86631502	missense	probably benign	0.09
R5790:Lonp2	UTSW	8	86631490	missense	probably benign	0.24
R5854:Lonp2	UTSW	8	86673071	critical splice donor site	probably null
R5884:Lonp2	UTSW	8	86641626	missense	probably damaging	1.00
R6025:Lonp2	UTSW	8	86713373	missense	probably damaging	1.00
R6236:Lonp2	UTSW	8	86636587	nonsense	probably null
R6481:Lonp2	UTSW	8	86634908	missense	possibly damaging	0.69
R6534:Lonp2	UTSW	8	86716458	missense	probably benign	0.00
R6805:Lonp2	UTSW	8	86709096	missense	probably benign
R6983:Lonp2	UTSW	8	86624248	missense	probably damaging	1.00
R7330:Lonp2	UTSW	8	86631394	missense	probably damaging	1.00
R7641:Lonp2	UTSW	8	86665758	missense	probably benign	0.02
R7674:Lonp2	UTSW	8	86665758	missense	probably benign	0.02
R7711:Lonp2	UTSW	8	86714008	missense	probably damaging	0.99
R7826:Lonp2	UTSW	8	86709013	missense	probably damaging	1.00
R7999:Lonp2	UTSW	8	86634909	missense	probably benign	0.02
R8057:Lonp2	UTSW	8	86714089	missense	probably damaging	1.00
R8193:Lonp2	UTSW	8	86631463	missense	probably damaging	1.00
R8716:Lonp2	UTSW	8	86716305	missense	probably benign	0.20
R8766:Lonp2	UTSW	8	86636570	missense	probably benign	0.00
R8813:Lonp2	UTSW	8	86631445	missense	probably damaging	1.00
R9049:Lonp2	UTSW	8	86709107	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCAAGTGATGTGATTTGAGAATGGGAT -3'
(R):5'- GGAACTCCCGACCCAGAGTCTT -3'

Sequencing Primer
(F):5'- gaggagaggtggagcgg -3'
(R):5'- AAACAGAGGATTGGGCCCTT -3'

Posted On

2014-03-14