Mutagenetix > Incidental Mutation

Incidental Mutation 'R1413:Atp10b'

159712

Institutional Source

Beutler Lab

Gene Symbol

Atp10b

Ensembl Gene

ENSMUSG00000055415

Gene Name

ATPase, class V, type 10B

Synonyms

5930426O13Rik, 9030605H24Rik

MMRRC Submission

039469-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R1413 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43149877-43262285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43230564 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 1018 (Q1018R)

Ref Sequence

ENSEMBL: ENSMUSP00000076844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077659]

AlphaFold

B1AWN4

Predicted Effect

probably benign
Transcript: ENSMUST00000077659
AA Change: Q1018R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000076844
Gene: ENSMUSG00000055415
AA Change: Q1018R

Domain	Start	End	E-Value	Type
Pfam:PhoLip_ATPase_N	47	118	3.8e-26	PFAM
Pfam:E1-E2_ATPase	123	393	2.9e-7	PFAM
low complexity region	621	638	N/A	INTRINSIC
Pfam:Cation_ATPase	692	799	7.1e-9	PFAM
Pfam:HAD	705	1062	6.7e-12	PFAM
Pfam:PhoLip_ATPase_C	1079	1324	1.9e-79	PFAM
low complexity region	1353	1366	N/A	INTRINSIC
low complexity region	1457	1471	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127604

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136288

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 91.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,590,496	V1504A	probably damaging	Het
Abcc9	T	C	6: 142,627,519	N1051D	possibly damaging	Het
Actr6	A	T	10: 89,728,157	Y84*	probably null	Het
Adgrl3	T	C	5: 81,693,519	Y816H	probably damaging	Het
Ahcyl2	T	C	6: 29,768,587		probably benign	Het
Amd1	A	T	10: 40,290,408	C157*	probably null	Het
Ank1	G	A	8: 23,119,377	E1362K	probably damaging	Het
Atp1a2	G	A	1: 172,279,344	T803I	probably damaging	Het
Atr	T	G	9: 95,932,442	L2064R	probably damaging	Het
Bmp3	T	A	5: 98,872,405	L229Q	probably damaging	Het
Ccl25	A	G	8: 4,353,892	*54W	probably null	Het
Cdc45	A	T	16: 18,808,741	N111K	possibly damaging	Het
Cfap61	T	A	2: 145,963,443	S154T	probably benign	Het
Cyp2c37	T	A	19: 39,994,098	S127T	probably benign	Het
Cyp4f40	T	A	17: 32,673,939	D309E	probably benign	Het
D6Ertd527e	A	G	6: 87,111,353	D166G	unknown	Het
Dmbt1	T	A	7: 131,050,214	D395E	probably damaging	Het
Dnah5	A	G	15: 28,370,409	S2832G	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Fah	T	C	7: 84,593,212	D296G	probably damaging	Het
Fam83g	A	G	11: 61,702,678	N346S	probably damaging	Het
Fgl1	T	A	8: 41,191,601	T289S	possibly damaging	Het
Fmo1	A	C	1: 162,833,862	L284R	probably damaging	Het
Frem3	T	A	8: 80,668,801	M1819K	probably benign	Het
Fsip2	T	A	2: 82,988,418	L4832M	possibly damaging	Het
Fut1	T	C	7: 45,619,428	W269R	probably damaging	Het
Ggnbp2	A	G	11: 84,833,129	Y638H	probably damaging	Het
Gp2	T	A	7: 119,451,630	I293F	probably benign	Het
Gpi1	T	C	7: 34,230,155	N20S	probably benign	Het
Gxylt1	C	T	15: 93,254,392	R222H	probably damaging	Het
Hemgn	T	C	4: 46,396,091	K382E	possibly damaging	Het
Hook3	T	A	8: 26,038,106	E585D	probably damaging	Het
Irf6	G	A	1: 193,169,305	M401I	probably benign	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Lactb	T	A	9: 66,970,919	R209S	probably damaging	Het
Lonp2	A	G	8: 86,641,584	D342G	probably damaging	Het
Mmachc	T	C	4: 116,705,997	S54G	probably damaging	Het
Mpp7	C	A	18: 7,350,977	W573C	probably damaging	Het
Olfr1133	T	A	2: 87,645,838	Y95F	probably benign	Het
Olfr1415	A	T	1: 92,490,888	I289N	probably damaging	Het
Olfr70	T	A	4: 43,697,011	H54L	possibly damaging	Het
Pappa2	A	T	1: 158,936,554	D462E	probably benign	Het
Pcdh12	A	T	18: 38,283,443	F210I	probably damaging	Het
Ppp1r12c	A	G	7: 4,484,444		probably null	Het
Prkce	T	A	17: 86,496,018	D448E	possibly damaging	Het
Ptprb	C	A	10: 116,339,679	T1193K	probably damaging	Het
Qrfpr	T	A	3: 36,182,660	E197D	possibly damaging	Het
Rusc2	T	A	4: 43,416,568	C625S	probably benign	Het
Shcbp1	T	G	8: 4,741,968		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spag5	T	A	11: 78,305,317	C449*	probably null	Het
Stpg3	T	C	2: 25,213,850	D158G	probably damaging	Het
Sycp2	T	C	2: 178,347,797	Y1423C	probably benign	Het
Tiprl	C	T	1: 165,215,790	E256K	possibly damaging	Het
Tmem132c	T	A	5: 127,563,567	V934D	probably damaging	Het
Topors	A	G	4: 40,261,982	V434A	probably benign	Het
Usp11	A	G	X: 20,718,707	Y731C	probably damaging	Het
Vmn2r58	T	A	7: 41,863,963	I419L	probably benign	Het
Wfs1	C	A	5: 36,982,078	R72L	possibly damaging	Het
Zan	T	C	5: 137,427,939	D2525G	unknown	Het
Zfp280c	A	G	X: 48,563,838	V285A	probably benign	Het
Zfp511	T	A	7: 140,037,615	F177I	probably damaging	Het
Zfp964	A	G	8: 69,663,070	M107V	unknown	Het
Zmynd11	A	G	13: 9,710,220	Y122H	probably damaging	Het

Other mutations in Atp10b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Atp10b	APN	11	43202161	missense	probably damaging	1.00
IGL01385:Atp10b	APN	11	43234429	missense	probably damaging	1.00
IGL01524:Atp10b	APN	11	43259845	missense	probably benign	0.18
IGL01575:Atp10b	APN	11	43172721	missense	probably benign	0.00
IGL01588:Atp10b	APN	11	43172721	missense	probably benign	0.00
IGL01590:Atp10b	APN	11	43172721	missense	probably benign	0.00
IGL01832:Atp10b	APN	11	43234435	missense	probably damaging	0.98
IGL01927:Atp10b	APN	11	43259404	splice site	probably benign
IGL01933:Atp10b	APN	11	43194630	missense	probably damaging	1.00
IGL02182:Atp10b	APN	11	43248947	missense	probably damaging	1.00
IGL02215:Atp10b	APN	11	43194665	critical splice donor site	probably null
IGL02216:Atp10b	APN	11	43259789	missense	probably damaging	0.98
IGL02973:Atp10b	APN	11	43197509	missense	probably damaging	1.00
IGL03012:Atp10b	APN	11	43194655	missense	probably damaging	0.99
IGL03106:Atp10b	APN	11	43247477	missense	probably benign	0.32
IGL03123:Atp10b	APN	11	43153283	missense	probably benign	0.01
IGL03202:Atp10b	APN	11	43234441	critical splice donor site	probably null
IGL03339:Atp10b	APN	11	43230615	missense	probably null	0.71
R0053:Atp10b	UTSW	11	43216564	splice site	probably benign
R0053:Atp10b	UTSW	11	43216564	splice site	probably benign
R0098:Atp10b	UTSW	11	43189604	missense	probably benign	0.00
R0098:Atp10b	UTSW	11	43189604	missense	probably benign	0.00
R0281:Atp10b	UTSW	11	43153304	missense	probably benign	0.00
R0379:Atp10b	UTSW	11	43254314	missense	probably benign	0.05
R0380:Atp10b	UTSW	11	43225597	missense	probably damaging	1.00
R0470:Atp10b	UTSW	11	43203039	missense	possibly damaging	0.88
R1355:Atp10b	UTSW	11	43151655	nonsense	probably null
R1368:Atp10b	UTSW	11	43202154	missense	probably damaging	1.00
R1370:Atp10b	UTSW	11	43151655	nonsense	probably null
R1502:Atp10b	UTSW	11	43230347	missense	probably damaging	1.00
R1530:Atp10b	UTSW	11	43197524	missense	probably benign	0.03
R1596:Atp10b	UTSW	11	43235767	missense	probably damaging	1.00
R1675:Atp10b	UTSW	11	43225648	missense	probably damaging	1.00
R1880:Atp10b	UTSW	11	43259432	missense	probably damaging	1.00
R1938:Atp10b	UTSW	11	43230418	missense	probably benign	0.00
R1986:Atp10b	UTSW	11	43172768	missense	probably benign	0.12
R2081:Atp10b	UTSW	11	43202128	missense	probably damaging	1.00
R2083:Atp10b	UTSW	11	43212423	missense	probably benign	0.24
R2159:Atp10b	UTSW	11	43151853	missense	possibly damaging	0.81
R2255:Atp10b	UTSW	11	43234380	missense	probably damaging	1.00
R2259:Atp10b	UTSW	11	43172745	missense	probably damaging	1.00
R2259:Atp10b	UTSW	11	43189613	missense	probably damaging	1.00
R3741:Atp10b	UTSW	11	43235662	missense	probably damaging	1.00
R3942:Atp10b	UTSW	11	43172754	missense	probably damaging	1.00
R3971:Atp10b	UTSW	11	43216512	missense	probably damaging	1.00
R4007:Atp10b	UTSW	11	43259852	missense	probably benign	0.04
R4050:Atp10b	UTSW	11	43259536	missense	probably benign	0.00
R4078:Atp10b	UTSW	11	43153283	missense	probably benign	0.01
R4567:Atp10b	UTSW	11	43197557	missense	probably benign	0.03
R4651:Atp10b	UTSW	11	43194645	missense	probably damaging	1.00
R4652:Atp10b	UTSW	11	43194645	missense	probably damaging	1.00
R4667:Atp10b	UTSW	11	43247518	missense	probably damaging	1.00
R4720:Atp10b	UTSW	11	43203122	missense	probably benign
R4987:Atp10b	UTSW	11	43151613	utr 5 prime	probably benign
R5232:Atp10b	UTSW	11	43202179	missense	probably damaging	1.00
R5233:Atp10b	UTSW	11	43230560	missense	probably benign	0.06
R5281:Atp10b	UTSW	11	43254336	missense	probably damaging	0.97
R5307:Atp10b	UTSW	11	43212475	missense	probably damaging	1.00
R5460:Atp10b	UTSW	11	43230455	missense	probably benign	0.00
R5518:Atp10b	UTSW	11	43151636	missense	possibly damaging	0.84
R5659:Atp10b	UTSW	11	43245425	missense	probably damaging	1.00
R5688:Atp10b	UTSW	11	43201173	missense	probably benign	0.00
R5735:Atp10b	UTSW	11	43151774	missense	probably benign	0.00
R6153:Atp10b	UTSW	11	43254282	missense	probably damaging	1.00
R6251:Atp10b	UTSW	11	43235746	missense	possibly damaging	0.95
R6259:Atp10b	UTSW	11	43201238	missense	probably benign	0.24
R6394:Atp10b	UTSW	11	43225637	missense	probably damaging	1.00
R6492:Atp10b	UTSW	11	43218957	missense	probably damaging	1.00
R6769:Atp10b	UTSW	11	43203252	critical splice donor site	probably null
R6771:Atp10b	UTSW	11	43203252	critical splice donor site	probably null
R6775:Atp10b	UTSW	11	43222213	missense	possibly damaging	0.80
R7134:Atp10b	UTSW	11	43245464	missense	probably damaging	1.00
R7322:Atp10b	UTSW	11	43212547	missense	probably damaging	1.00
R7367:Atp10b	UTSW	11	43247501	missense	probably damaging	1.00
R7538:Atp10b	UTSW	11	43225546	missense	probably benign	0.04
R7708:Atp10b	UTSW	11	43202143	missense	probably damaging	1.00
R7787:Atp10b	UTSW	11	43259873	missense	possibly damaging	0.91
R8145:Atp10b	UTSW	11	43202122	missense	probably damaging	1.00
R8406:Atp10b	UTSW	11	43203157	missense	probably benign	0.00
R8503:Atp10b	UTSW	11	43222239	missense	possibly damaging	0.92
R8542:Atp10b	UTSW	11	43230381	missense	probably benign	0.18
R8744:Atp10b	UTSW	11	43230350	missense	probably damaging	1.00
R8815:Atp10b	UTSW	11	43203151	missense	possibly damaging	0.63
R8833:Atp10b	UTSW	11	43222159	missense	probably damaging	1.00
R8880:Atp10b	UTSW	11	43215984	missense	probably benign
R8989:Atp10b	UTSW	11	43245442	nonsense	probably null
R8998:Atp10b	UTSW	11	43259899	makesense	probably null
R9255:Atp10b	UTSW	11	43216321	missense	probably damaging	1.00
R9281:Atp10b	UTSW	11	43225631	missense	probably benign	0.11
R9345:Atp10b	UTSW	11	43203197	missense	probably damaging	0.99
R9357:Atp10b	UTSW	11	43259884	missense	probably benign	0.18
R9393:Atp10b	UTSW	11	43172781	missense	probably damaging	1.00
R9516:Atp10b	UTSW	11	43230397	missense	probably benign	0.02
R9644:Atp10b	UTSW	11	43151832	missense	probably damaging	1.00
R9747:Atp10b	UTSW	11	43197512	missense	probably benign
Z1177:Atp10b	UTSW	11	43153349	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GCCATCTTGCAACAGCCACTTCTAC -3'
(R):5'- AGGTGAATCCTGCCCAGATACCAC -3'

Sequencing Primer
(F):5'- TCTGTAGGAAACCTGCGAGTC -3'
(R):5'- ACCCACATCCCAGGCTG -3'

Posted On

2014-03-14