Incidental Mutation 'R1413:Fam83g'
ID 159713
Institutional Source Beutler Lab
Gene Symbol Fam83g
Ensembl Gene ENSMUSG00000042377
Gene Name family with sequence similarity 83, member G
Synonyms wly, 2310040C09Rik
MMRRC Submission 039469-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R1413 (G1)
Quality Score 157
Status Not validated
Chromosome 11
Chromosomal Location 61574917-61600777 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 61593504 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 346 (N346S)
Ref Sequence ENSEMBL: ENSMUSP00000090697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051552] [ENSMUST00000093019] [ENSMUST00000148584] [ENSMUST00000151780]
AlphaFold Q5SWY7
Predicted Effect probably benign
Transcript: ENSMUST00000051552
SMART Domains Protein: ENSMUSP00000054407
Gene: ENSMUSG00000042371

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093019
AA Change: N346S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090697
Gene: ENSMUSG00000042377
AA Change: N346S

DomainStartEndE-ValueType
Pfam:DUF1669 15 309 1.8e-120 PFAM
Pfam:PLDc_2 165 304 5.5e-11 PFAM
low complexity region 316 336 N/A INTRINSIC
low complexity region 468 481 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
low complexity region 721 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128196
Predicted Effect probably benign
Transcript: ENSMUST00000148584
SMART Domains Protein: ENSMUSP00000114523
Gene: ENSMUSG00000042371

DomainStartEndE-ValueType
Pfam:SSF 50 479 2.4e-139 PFAM
transmembrane domain 513 535 N/A INTRINSIC
transmembrane domain 576 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151780
SMART Domains Protein: ENSMUSP00000118196
Gene: ENSMUSG00000042371

DomainStartEndE-ValueType
Pfam:SSF 48 185 3.5e-44 PFAM
Pfam:SSF 182 450 5e-79 PFAM
transmembrane domain 484 506 N/A INTRINSIC
transmembrane domain 547 566 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations at this locus result in curly hair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,573,245 (GRCm39) N1051D possibly damaging Het
Abcc9 A G 6: 142,536,222 (GRCm39) V1504A probably damaging Het
Actr6 A T 10: 89,564,019 (GRCm39) Y84* probably null Het
Adgrl3 T C 5: 81,841,366 (GRCm39) Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,586 (GRCm39) probably benign Het
Amd1 A T 10: 40,166,404 (GRCm39) C157* probably null Het
Ank1 G A 8: 23,609,393 (GRCm39) E1362K probably damaging Het
Atp10b A G 11: 43,121,391 (GRCm39) Q1018R probably benign Het
Atp1a2 G A 1: 172,106,911 (GRCm39) T803I probably damaging Het
Atr T G 9: 95,814,495 (GRCm39) L2064R probably damaging Het
Bmp3 T A 5: 99,020,264 (GRCm39) L229Q probably damaging Het
Ccl25 A G 8: 4,403,892 (GRCm39) *54W probably null Het
Cdc45 A T 16: 18,627,491 (GRCm39) N111K possibly damaging Het
Cfap61 T A 2: 145,805,363 (GRCm39) S154T probably benign Het
Cyp2c37 T A 19: 39,982,542 (GRCm39) S127T probably benign Het
Cyp4f40 T A 17: 32,892,913 (GRCm39) D309E probably benign Het
D6Ertd527e A G 6: 87,088,335 (GRCm39) D166G unknown Het
Dmbt1 T A 7: 130,651,944 (GRCm39) D395E probably damaging Het
Dnah5 A G 15: 28,370,555 (GRCm39) S2832G probably benign Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Fah T C 7: 84,242,420 (GRCm39) D296G probably damaging Het
Fgl1 T A 8: 41,644,638 (GRCm39) T289S possibly damaging Het
Fmo1 A C 1: 162,661,431 (GRCm39) L284R probably damaging Het
Frem3 T A 8: 81,395,430 (GRCm39) M1819K probably benign Het
Fsip2 T A 2: 82,818,762 (GRCm39) L4832M possibly damaging Het
Fut1 T C 7: 45,268,852 (GRCm39) W269R probably damaging Het
Ggnbp2 A G 11: 84,723,955 (GRCm39) Y638H probably damaging Het
Gp2 T A 7: 119,050,853 (GRCm39) I293F probably benign Het
Gpi1 T C 7: 33,929,580 (GRCm39) N20S probably benign Het
Gxylt1 C T 15: 93,152,273 (GRCm39) R222H probably damaging Het
Hemgn T C 4: 46,396,091 (GRCm39) K382E possibly damaging Het
Hook3 T A 8: 26,528,134 (GRCm39) E585D probably damaging Het
Irf6 G A 1: 192,851,613 (GRCm39) M401I probably benign Het
Jmjd1c A G 10: 67,085,529 (GRCm39) T2259A probably damaging Het
Lactb T A 9: 66,878,201 (GRCm39) R209S probably damaging Het
Lonp2 A G 8: 87,368,212 (GRCm39) D342G probably damaging Het
Mmachc T C 4: 116,563,194 (GRCm39) S54G probably damaging Het
Mpp7 C A 18: 7,350,977 (GRCm39) W573C probably damaging Het
Or13e8 T A 4: 43,697,011 (GRCm39) H54L possibly damaging Het
Or5w1b T A 2: 87,476,182 (GRCm39) Y95F probably benign Het
Or6b2b A T 1: 92,418,610 (GRCm39) I289N probably damaging Het
Pappa2 A T 1: 158,764,124 (GRCm39) D462E probably benign Het
Pcdh12 A T 18: 38,416,496 (GRCm39) F210I probably damaging Het
Ppp1r12c A G 7: 4,487,443 (GRCm39) probably null Het
Prkce T A 17: 86,803,446 (GRCm39) D448E possibly damaging Het
Ptprb C A 10: 116,175,584 (GRCm39) T1193K probably damaging Het
Qrfpr T A 3: 36,236,809 (GRCm39) E197D possibly damaging Het
Rusc2 T A 4: 43,416,568 (GRCm39) C625S probably benign Het
Shcbp1 T G 8: 4,791,968 (GRCm39) probably null Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spag5 T A 11: 78,196,143 (GRCm39) C449* probably null Het
Stpg3 T C 2: 25,103,862 (GRCm39) D158G probably damaging Het
Sycp2 T C 2: 177,989,590 (GRCm39) Y1423C probably benign Het
Tiprl C T 1: 165,043,359 (GRCm39) E256K possibly damaging Het
Tmem132c T A 5: 127,640,631 (GRCm39) V934D probably damaging Het
Topors A G 4: 40,261,982 (GRCm39) V434A probably benign Het
Usp11 A G X: 20,584,946 (GRCm39) Y731C probably damaging Het
Vmn2r58 T A 7: 41,513,387 (GRCm39) I419L probably benign Het
Wfs1 C A 5: 37,139,422 (GRCm39) R72L possibly damaging Het
Zan T C 5: 137,426,201 (GRCm39) D2525G unknown Het
Zfp280c A G X: 47,652,715 (GRCm39) V285A probably benign Het
Zfp511 T A 7: 139,617,528 (GRCm39) F177I probably damaging Het
Zfp964 A G 8: 70,115,720 (GRCm39) M107V unknown Het
Zmynd11 A G 13: 9,760,256 (GRCm39) Y122H probably damaging Het
Other mutations in Fam83g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02121:Fam83g APN 11 61,575,609 (GRCm39) missense probably benign 0.00
IGL02958:Fam83g APN 11 61,598,548 (GRCm39) missense probably damaging 1.00
PIT4402001:Fam83g UTSW 11 61,594,422 (GRCm39) missense probably damaging 0.99
R0365:Fam83g UTSW 11 61,593,935 (GRCm39) nonsense probably null
R0410:Fam83g UTSW 11 61,594,218 (GRCm39) missense probably damaging 1.00
R0555:Fam83g UTSW 11 61,598,489 (GRCm39) missense probably benign 0.37
R1163:Fam83g UTSW 11 61,594,262 (GRCm39) missense probably damaging 1.00
R1474:Fam83g UTSW 11 61,593,819 (GRCm39) missense probably damaging 1.00
R1916:Fam83g UTSW 11 61,585,994 (GRCm39) missense probably damaging 1.00
R2006:Fam83g UTSW 11 61,593,801 (GRCm39) missense possibly damaging 0.94
R2105:Fam83g UTSW 11 61,594,284 (GRCm39) missense probably benign 0.01
R2134:Fam83g UTSW 11 61,594,510 (GRCm39) missense probably benign 0.00
R2968:Fam83g UTSW 11 61,594,304 (GRCm39) missense probably damaging 0.97
R4274:Fam83g UTSW 11 61,592,554 (GRCm39) missense probably damaging 1.00
R4753:Fam83g UTSW 11 61,586,095 (GRCm39) missense probably damaging 1.00
R5888:Fam83g UTSW 11 61,593,420 (GRCm39) missense probably benign 0.38
R6280:Fam83g UTSW 11 61,594,008 (GRCm39) missense probably benign 0.00
R7234:Fam83g UTSW 11 61,593,342 (GRCm39) missense possibly damaging 0.75
R7257:Fam83g UTSW 11 61,575,579 (GRCm39) missense probably damaging 1.00
R7588:Fam83g UTSW 11 61,575,522 (GRCm39) missense probably damaging 1.00
R7761:Fam83g UTSW 11 61,575,584 (GRCm39) missense possibly damaging 0.90
R9624:Fam83g UTSW 11 61,575,328 (GRCm39) intron probably benign
Z1176:Fam83g UTSW 11 61,598,296 (GRCm39) missense probably benign 0.08
Z1186:Fam83g UTSW 11 61,594,020 (GRCm39) missense probably benign 0.00
Z1187:Fam83g UTSW 11 61,594,020 (GRCm39) missense probably benign 0.00
Z1188:Fam83g UTSW 11 61,594,020 (GRCm39) missense probably benign 0.00
Z1189:Fam83g UTSW 11 61,594,020 (GRCm39) missense probably benign 0.00
Z1190:Fam83g UTSW 11 61,594,020 (GRCm39) missense probably benign 0.00
Z1191:Fam83g UTSW 11 61,594,020 (GRCm39) missense probably benign 0.00
Z1192:Fam83g UTSW 11 61,594,020 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGTATGCACTGTTGATGCCCAC -3'
(R):5'- ATATTGGCCCTCTCCAGGTTGAGC -3'

Sequencing Primer
(F):5'- ATTGTAGCTTCACATGGTCAGC -3'
(R):5'- TTGAGCAGCCCTGGGTG -3'
Posted On 2014-03-14