Mutagenetix > Incidental Mutation

Incidental Mutation 'R1413:Spag5'

159715

Institutional Source

Beutler Lab

Gene Symbol

Spag5

Ensembl Gene

ENSMUSG00000002055

Gene Name

sperm associated antigen 5

Synonyms

D11Bhm180e, Astrin, MAP126, Deepest, Mastrin, S17, s17

MMRRC Submission

039469-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1413 (G1)

Quality Score

178

Status

Not validated

Chromosome

Chromosomal Location

78301529-78322457 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 78305317 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 449 (C449*)

Ref Sequence

ENSEMBL: ENSMUSP00000045286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045026]

AlphaFold

Q7TME2

Predicted Effect

probably null
Transcript: ENSMUST00000045026
AA Change: C449*

SMART Domains

Protein: ENSMUSP00000045286
Gene: ENSMUSG00000002055
AA Change: C449*

Domain	Start	End	E-Value	Type
low complexity region	405	420	N/A	INTRINSIC
low complexity region	477	493	N/A	INTRINSIC
coiled coil region	514	547	N/A	INTRINSIC
coiled coil region	638	700	N/A	INTRINSIC
coiled coil region	743	854	N/A	INTRINSIC
low complexity region	898	912	N/A	INTRINSIC
coiled coil region	970	1006	N/A	INTRINSIC
coiled coil region	1032	1068	N/A	INTRINSIC
coiled coil region	1104	1140	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133579

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146068

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the mitotic spindle apparatus. The encoded protein may be involved in the functional and dynamic regulation of mitotic spindles. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable and fertile with normal breeding and mating behavio; no abnormalities in male reproductive system anatomy or histology or in spermatogenesis were detectable. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,590,496	V1504A	probably damaging	Het
Abcc9	T	C	6: 142,627,519	N1051D	possibly damaging	Het
Actr6	A	T	10: 89,728,157	Y84*	probably null	Het
Adgrl3	T	C	5: 81,693,519	Y816H	probably damaging	Het
Ahcyl2	T	C	6: 29,768,587		probably benign	Het
Amd1	A	T	10: 40,290,408	C157*	probably null	Het
Ank1	G	A	8: 23,119,377	E1362K	probably damaging	Het
Atp10b	A	G	11: 43,230,564	Q1018R	probably benign	Het
Atp1a2	G	A	1: 172,279,344	T803I	probably damaging	Het
Atr	T	G	9: 95,932,442	L2064R	probably damaging	Het
Bmp3	T	A	5: 98,872,405	L229Q	probably damaging	Het
Ccl25	A	G	8: 4,353,892	*54W	probably null	Het
Cdc45	A	T	16: 18,808,741	N111K	possibly damaging	Het
Cfap61	T	A	2: 145,963,443	S154T	probably benign	Het
Cyp2c37	T	A	19: 39,994,098	S127T	probably benign	Het
Cyp4f40	T	A	17: 32,673,939	D309E	probably benign	Het
D6Ertd527e	A	G	6: 87,111,353	D166G	unknown	Het
Dmbt1	T	A	7: 131,050,214	D395E	probably damaging	Het
Dnah5	A	G	15: 28,370,409	S2832G	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Fah	T	C	7: 84,593,212	D296G	probably damaging	Het
Fam83g	A	G	11: 61,702,678	N346S	probably damaging	Het
Fgl1	T	A	8: 41,191,601	T289S	possibly damaging	Het
Fmo1	A	C	1: 162,833,862	L284R	probably damaging	Het
Frem3	T	A	8: 80,668,801	M1819K	probably benign	Het
Fsip2	T	A	2: 82,988,418	L4832M	possibly damaging	Het
Fut1	T	C	7: 45,619,428	W269R	probably damaging	Het
Ggnbp2	A	G	11: 84,833,129	Y638H	probably damaging	Het
Gp2	T	A	7: 119,451,630	I293F	probably benign	Het
Gpi1	T	C	7: 34,230,155	N20S	probably benign	Het
Gxylt1	C	T	15: 93,254,392	R222H	probably damaging	Het
Hemgn	T	C	4: 46,396,091	K382E	possibly damaging	Het
Hook3	T	A	8: 26,038,106	E585D	probably damaging	Het
Irf6	G	A	1: 193,169,305	M401I	probably benign	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Lactb	T	A	9: 66,970,919	R209S	probably damaging	Het
Lonp2	A	G	8: 86,641,584	D342G	probably damaging	Het
Mmachc	T	C	4: 116,705,997	S54G	probably damaging	Het
Mpp7	C	A	18: 7,350,977	W573C	probably damaging	Het
Olfr1133	T	A	2: 87,645,838	Y95F	probably benign	Het
Olfr1415	A	T	1: 92,490,888	I289N	probably damaging	Het
Olfr70	T	A	4: 43,697,011	H54L	possibly damaging	Het
Pappa2	A	T	1: 158,936,554	D462E	probably benign	Het
Pcdh12	A	T	18: 38,283,443	F210I	probably damaging	Het
Ppp1r12c	A	G	7: 4,484,444		probably null	Het
Prkce	T	A	17: 86,496,018	D448E	possibly damaging	Het
Ptprb	C	A	10: 116,339,679	T1193K	probably damaging	Het
Qrfpr	T	A	3: 36,182,660	E197D	possibly damaging	Het
Rusc2	T	A	4: 43,416,568	C625S	probably benign	Het
Shcbp1	T	G	8: 4,741,968		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Stpg3	T	C	2: 25,213,850	D158G	probably damaging	Het
Sycp2	T	C	2: 178,347,797	Y1423C	probably benign	Het
Tiprl	C	T	1: 165,215,790	E256K	possibly damaging	Het
Tmem132c	T	A	5: 127,563,567	V934D	probably damaging	Het
Topors	A	G	4: 40,261,982	V434A	probably benign	Het
Usp11	A	G	X: 20,718,707	Y731C	probably damaging	Het
Vmn2r58	T	A	7: 41,863,963	I419L	probably benign	Het
Wfs1	C	A	5: 36,982,078	R72L	possibly damaging	Het
Zan	T	C	5: 137,427,939	D2525G	unknown	Het
Zfp280c	A	G	X: 48,563,838	V285A	probably benign	Het
Zfp511	T	A	7: 140,037,615	F177I	probably damaging	Het
Zfp964	A	G	8: 69,663,070	M107V	unknown	Het
Zmynd11	A	G	13: 9,710,220	Y122H	probably damaging	Het

Other mutations in Spag5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Spag5	APN	11	78304617	missense	possibly damaging	0.62
IGL01820:Spag5	APN	11	78304259	missense	probably benign	0.06
IGL02066:Spag5	APN	11	78304532	missense	probably benign
IGL02140:Spag5	APN	11	78315633	missense	possibly damaging	0.62
IGL02251:Spag5	APN	11	78320034	missense	probably damaging	1.00
IGL02452:Spag5	APN	11	78304623	missense	probably benign	0.08
IGL02658:Spag5	APN	11	78321331	nonsense	probably null
boyardee	UTSW	11	78313191	critical splice donor site	probably null
Franco	UTSW	11	78314182	nonsense	probably null
spaghetto	UTSW	11	78313379	nonsense	probably null
IGL02991:Spag5	UTSW	11	78314251	missense	probably damaging	0.99
R0477:Spag5	UTSW	11	78314198	missense	probably damaging	1.00
R0512:Spag5	UTSW	11	78319586	unclassified	probably benign
R0535:Spag5	UTSW	11	78304728	missense	probably benign	0.00
R0557:Spag5	UTSW	11	78314211	missense	probably damaging	0.99
R0584:Spag5	UTSW	11	78304095	missense	possibly damaging	0.49
R0666:Spag5	UTSW	11	78313396	missense	probably damaging	1.00
R0723:Spag5	UTSW	11	78319584	unclassified	probably benign
R1680:Spag5	UTSW	11	78320616	missense	probably damaging	1.00
R1687:Spag5	UTSW	11	78304929	missense	probably benign	0.32
R1696:Spag5	UTSW	11	78321326	missense	probably damaging	1.00
R1831:Spag5	UTSW	11	78314256	missense	probably benign	0.08
R1866:Spag5	UTSW	11	78304455	missense	possibly damaging	0.62
R1918:Spag5	UTSW	11	78304176	missense	probably benign	0.01
R4004:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4005:Spag5	UTSW	11	78321529	missense	probably benign	0.22
R4222:Spag5	UTSW	11	78304511	missense	probably damaging	1.00
R4750:Spag5	UTSW	11	78320052	missense	probably benign	0.00
R4771:Spag5	UTSW	11	78304766	missense	probably damaging	1.00
R4928:Spag5	UTSW	11	78314373	missense	probably damaging	0.97
R5360:Spag5	UTSW	11	78314762	missense	probably damaging	0.99
R5366:Spag5	UTSW	11	78320326	splice site	probably null
R5618:Spag5	UTSW	11	78304080	missense	probably benign	0.00
R5668:Spag5	UTSW	11	78304716	missense	possibly damaging	0.53
R5762:Spag5	UTSW	11	78304146	missense	probably benign	0.25
R5859:Spag5	UTSW	11	78313534	missense	probably benign	0.38
R6564:Spag5	UTSW	11	78315575	missense	probably damaging	1.00
R6571:Spag5	UTSW	11	78321269	missense	probably damaging	1.00
R6573:Spag5	UTSW	11	78314182	nonsense	probably null
R7074:Spag5	UTSW	11	78305042	critical splice donor site	probably null
R7091:Spag5	UTSW	11	78313191	critical splice donor site	probably null
R7332:Spag5	UTSW	11	78313379	nonsense	probably null
R8073:Spag5	UTSW	11	78301977	missense	probably benign	0.22
R8709:Spag5	UTSW	11	78301912	missense	probably benign
R8723:Spag5	UTSW	11	78321389	missense	probably damaging	1.00
R8976:Spag5	UTSW	11	78304587	missense	probably benign	0.01
R9053:Spag5	UTSW	11	78321749	missense	probably benign	0.14
R9142:Spag5	UTSW	11	78301997	missense	possibly damaging	0.56
Z1176:Spag5	UTSW	11	78314982	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TCCCGACACGACTTGGAAGAGAAC -3'
(R):5'- GGATGTACTCAGTCCAGGAAATGCC -3'

Sequencing Primer
(F):5'- CTTGGAAGAGAACCTGTTGAACTC -3'
(R):5'- aatccacctgcctttatctcc -3'

Posted On

2014-03-14