Mutagenetix > Incidental Mutation

Incidental Mutation 'R1413:Prkce'

159724

Institutional Source

Beutler Lab

Gene Symbol

Prkce

Ensembl Gene

ENSMUSG00000045038

Gene Name

protein kinase C, epsilon

Synonyms

Pkce, PKCepsilon, PKC[e], 5830406C15Rik

MMRRC Submission

039469-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1413 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86167785-86657919 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86496018 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 448 (D448E)

Ref Sequence

ENSEMBL: ENSMUSP00000094874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095186] [ENSMUST00000097274] [ENSMUST00000097275]

AlphaFold

P16054

Predicted Effect

probably benign
Transcript: ENSMUST00000095186

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097274
AA Change: D448E

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000094873
Gene: ENSMUSG00000045038
AA Change: D448E

Domain	Start	End	E-Value	Type
C2	7	114	5.78e-12	SMART
C1	170	220	4.48e-13	SMART
C1	243	292	8.29e-17	SMART
S_TKc	408	668	1.3e-104	SMART
S_TK_X	669	732	2.56e-25	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097275
AA Change: D448E

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000094874
Gene: ENSMUSG00000045038
AA Change: D448E

Domain	Start	End	E-Value	Type
C2	7	114	5.78e-12	SMART
C1	170	220	4.48e-13	SMART
C1	243	292	8.29e-17	SMART
S_TKc	408	668	1.3e-104	SMART
S_TK_X	669	732	2.56e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136986

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150486

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced ethanol self-administration and are more sensitive to the acute behavioral effects of ethanol and other drugs that activate GABA(A) receptors. Mutants show reduced anxiety and stress hormones. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,590,496	V1504A	probably damaging	Het
Abcc9	T	C	6: 142,627,519	N1051D	possibly damaging	Het
Actr6	A	T	10: 89,728,157	Y84*	probably null	Het
Adgrl3	T	C	5: 81,693,519	Y816H	probably damaging	Het
Ahcyl2	T	C	6: 29,768,587		probably benign	Het
Amd1	A	T	10: 40,290,408	C157*	probably null	Het
Ank1	G	A	8: 23,119,377	E1362K	probably damaging	Het
Atp10b	A	G	11: 43,230,564	Q1018R	probably benign	Het
Atp1a2	G	A	1: 172,279,344	T803I	probably damaging	Het
Atr	T	G	9: 95,932,442	L2064R	probably damaging	Het
Bmp3	T	A	5: 98,872,405	L229Q	probably damaging	Het
Ccl25	A	G	8: 4,353,892	*54W	probably null	Het
Cdc45	A	T	16: 18,808,741	N111K	possibly damaging	Het
Cfap61	T	A	2: 145,963,443	S154T	probably benign	Het
Cyp2c37	T	A	19: 39,994,098	S127T	probably benign	Het
Cyp4f40	T	A	17: 32,673,939	D309E	probably benign	Het
D6Ertd527e	A	G	6: 87,111,353	D166G	unknown	Het
Dmbt1	T	A	7: 131,050,214	D395E	probably damaging	Het
Dnah5	A	G	15: 28,370,409	S2832G	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Fah	T	C	7: 84,593,212	D296G	probably damaging	Het
Fam83g	A	G	11: 61,702,678	N346S	probably damaging	Het
Fgl1	T	A	8: 41,191,601	T289S	possibly damaging	Het
Fmo1	A	C	1: 162,833,862	L284R	probably damaging	Het
Frem3	T	A	8: 80,668,801	M1819K	probably benign	Het
Fsip2	T	A	2: 82,988,418	L4832M	possibly damaging	Het
Fut1	T	C	7: 45,619,428	W269R	probably damaging	Het
Ggnbp2	A	G	11: 84,833,129	Y638H	probably damaging	Het
Gp2	T	A	7: 119,451,630	I293F	probably benign	Het
Gpi1	T	C	7: 34,230,155	N20S	probably benign	Het
Gxylt1	C	T	15: 93,254,392	R222H	probably damaging	Het
Hemgn	T	C	4: 46,396,091	K382E	possibly damaging	Het
Hook3	T	A	8: 26,038,106	E585D	probably damaging	Het
Irf6	G	A	1: 193,169,305	M401I	probably benign	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Lactb	T	A	9: 66,970,919	R209S	probably damaging	Het
Lonp2	A	G	8: 86,641,584	D342G	probably damaging	Het
Mmachc	T	C	4: 116,705,997	S54G	probably damaging	Het
Mpp7	C	A	18: 7,350,977	W573C	probably damaging	Het
Olfr1133	T	A	2: 87,645,838	Y95F	probably benign	Het
Olfr1415	A	T	1: 92,490,888	I289N	probably damaging	Het
Olfr70	T	A	4: 43,697,011	H54L	possibly damaging	Het
Pappa2	A	T	1: 158,936,554	D462E	probably benign	Het
Pcdh12	A	T	18: 38,283,443	F210I	probably damaging	Het
Ppp1r12c	A	G	7: 4,484,444		probably null	Het
Ptprb	C	A	10: 116,339,679	T1193K	probably damaging	Het
Qrfpr	T	A	3: 36,182,660	E197D	possibly damaging	Het
Rusc2	T	A	4: 43,416,568	C625S	probably benign	Het
Shcbp1	T	G	8: 4,741,968		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spag5	T	A	11: 78,305,317	C449*	probably null	Het
Stpg3	T	C	2: 25,213,850	D158G	probably damaging	Het
Sycp2	T	C	2: 178,347,797	Y1423C	probably benign	Het
Tiprl	C	T	1: 165,215,790	E256K	possibly damaging	Het
Tmem132c	T	A	5: 127,563,567	V934D	probably damaging	Het
Topors	A	G	4: 40,261,982	V434A	probably benign	Het
Usp11	A	G	X: 20,718,707	Y731C	probably damaging	Het
Vmn2r58	T	A	7: 41,863,963	I419L	probably benign	Het
Wfs1	C	A	5: 36,982,078	R72L	possibly damaging	Het
Zan	T	C	5: 137,427,939	D2525G	unknown	Het
Zfp280c	A	G	X: 48,563,838	V285A	probably benign	Het
Zfp511	T	A	7: 140,037,615	F177I	probably damaging	Het
Zfp964	A	G	8: 69,663,070	M107V	unknown	Het
Zmynd11	A	G	13: 9,710,220	Y122H	probably damaging	Het

Other mutations in Prkce

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Prkce	APN	17	86625462	missense	probably damaging	0.99
IGL01401:Prkce	APN	17	86168840	missense	probably damaging	1.00
IGL01508:Prkce	APN	17	86630085	missense	probably damaging	1.00
IGL02500:Prkce	APN	17	86168914	missense	probably benign	0.16
IGL02957:Prkce	APN	17	86496026	missense	possibly damaging	0.74
IGL03114:Prkce	APN	17	86654555	missense	probably damaging	0.97
Pinnacles	UTSW	17	86476851	missense	probably damaging	1.00
R0063:Prkce	UTSW	17	86482111	splice site	probably benign
R0063:Prkce	UTSW	17	86482111	splice site	probably benign
R0403:Prkce	UTSW	17	86168653	missense	probably damaging	0.98
R0900:Prkce	UTSW	17	86625458	missense	probably damaging	1.00
R0919:Prkce	UTSW	17	86630160	missense	probably benign	0.06
R1430:Prkce	UTSW	17	86559137	splice site	probably benign
R1843:Prkce	UTSW	17	86475546	nonsense	probably null
R2129:Prkce	UTSW	17	86496035	missense	possibly damaging	0.89
R2341:Prkce	UTSW	17	86474442	missense	probably damaging	1.00
R2511:Prkce	UTSW	17	86625326	missense	probably damaging	1.00
R2679:Prkce	UTSW	17	86176226	intron	probably benign
R3724:Prkce	UTSW	17	86168623	nonsense	probably null
R3853:Prkce	UTSW	17	86168849	missense	probably damaging	1.00
R4364:Prkce	UTSW	17	86476851	missense	probably damaging	1.00
R4467:Prkce	UTSW	17	86619911	missense	possibly damaging	0.68
R4523:Prkce	UTSW	17	86490750	critical splice acceptor site	probably null
R4838:Prkce	UTSW	17	86630083	missense	probably benign	0.07
R5140:Prkce	UTSW	17	86482142	missense	probably benign	0.12
R5579:Prkce	UTSW	17	86619948	missense	probably damaging	1.00
R6026:Prkce	UTSW	17	86493230	missense	probably benign	0.02
R6048:Prkce	UTSW	17	86493347	missense	probably benign
R6212:Prkce	UTSW	17	86559301	missense	probably damaging	1.00
R6484:Prkce	UTSW	17	86490809	missense	probably benign
R6788:Prkce	UTSW	17	86630061	missense	probably damaging	1.00
R6915:Prkce	UTSW	17	86493407	missense	probably damaging	1.00
R7349:Prkce	UTSW	17	86493355	missense	probably benign
R7447:Prkce	UTSW	17	86559259	missense	probably damaging	1.00
R7566:Prkce	UTSW	17	86493329	missense	probably benign	0.00
R7577:Prkce	UTSW	17	86493293	nonsense	probably null
R7638:Prkce	UTSW	17	86168600	missense	probably benign	0.26
R8237:Prkce	UTSW	17	86559218	missense	probably damaging	1.00
R8711:Prkce	UTSW	17	86488197	missense	probably damaging	1.00
R8869:Prkce	UTSW	17	86168942	critical splice donor site	probably null
R9342:Prkce	UTSW	17	86474449	missense	probably damaging	1.00
RF010:Prkce	UTSW	17	86488199	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TCTTACCTGAGCACTGTGCCAGAG -3'
(R):5'- CGCAGACGGTCAAAAGTGGTTTC -3'

Sequencing Primer
(F):5'- AAAACCCCTTAGGTAGTTTCCC -3'
(R):5'- ACGGTCAAAAGTGGTTTCTGATAG -3'

Posted On

2014-03-14