Incidental Mutation 'R1413:Prkce'
ID159724
Institutional Source Beutler Lab
Gene Symbol Prkce
Ensembl Gene ENSMUSG00000045038
Gene Nameprotein kinase C, epsilon
SynonymsPkce, PKCepsilon, PKC[e], 5830406C15Rik
MMRRC Submission 039469-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1413 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location86167785-86657919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86496018 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 448 (D448E)
Ref Sequence ENSEMBL: ENSMUSP00000094874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095186] [ENSMUST00000097274] [ENSMUST00000097275]
Predicted Effect probably benign
Transcript: ENSMUST00000095186
Predicted Effect possibly damaging
Transcript: ENSMUST00000097274
AA Change: D448E

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094873
Gene: ENSMUSG00000045038
AA Change: D448E

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000097275
AA Change: D448E

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000094874
Gene: ENSMUSG00000045038
AA Change: D448E

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150486
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced ethanol self-administration and are more sensitive to the acute behavioral effects of ethanol and other drugs that activate GABA(A) receptors. Mutants show reduced anxiety and stress hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,590,496 V1504A probably damaging Het
Abcc9 T C 6: 142,627,519 N1051D possibly damaging Het
Actr6 A T 10: 89,728,157 Y84* probably null Het
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,587 probably benign Het
Amd1 A T 10: 40,290,408 C157* probably null Het
Ank1 G A 8: 23,119,377 E1362K probably damaging Het
Atp10b A G 11: 43,230,564 Q1018R probably benign Het
Atp1a2 G A 1: 172,279,344 T803I probably damaging Het
Atr T G 9: 95,932,442 L2064R probably damaging Het
Bmp3 T A 5: 98,872,405 L229Q probably damaging Het
Ccl25 A G 8: 4,353,892 *54W probably null Het
Cdc45 A T 16: 18,808,741 N111K possibly damaging Het
Cfap61 T A 2: 145,963,443 S154T probably benign Het
Cyp2c37 T A 19: 39,994,098 S127T probably benign Het
Cyp4f40 T A 17: 32,673,939 D309E probably benign Het
D6Ertd527e A G 6: 87,111,353 D166G unknown Het
Dmbt1 T A 7: 131,050,214 D395E probably damaging Het
Dnah5 A G 15: 28,370,409 S2832G probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fah T C 7: 84,593,212 D296G probably damaging Het
Fam83g A G 11: 61,702,678 N346S probably damaging Het
Fgl1 T A 8: 41,191,601 T289S possibly damaging Het
Fmo1 A C 1: 162,833,862 L284R probably damaging Het
Frem3 T A 8: 80,668,801 M1819K probably benign Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Fut1 T C 7: 45,619,428 W269R probably damaging Het
Ggnbp2 A G 11: 84,833,129 Y638H probably damaging Het
Gp2 T A 7: 119,451,630 I293F probably benign Het
Gpi1 T C 7: 34,230,155 N20S probably benign Het
Gxylt1 C T 15: 93,254,392 R222H probably damaging Het
Hemgn T C 4: 46,396,091 K382E possibly damaging Het
Hook3 T A 8: 26,038,106 E585D probably damaging Het
Irf6 G A 1: 193,169,305 M401I probably benign Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Lactb T A 9: 66,970,919 R209S probably damaging Het
Lonp2 A G 8: 86,641,584 D342G probably damaging Het
Mmachc T C 4: 116,705,997 S54G probably damaging Het
Mpp7 C A 18: 7,350,977 W573C probably damaging Het
Olfr1133 T A 2: 87,645,838 Y95F probably benign Het
Olfr1415 A T 1: 92,490,888 I289N probably damaging Het
Olfr70 T A 4: 43,697,011 H54L possibly damaging Het
Pappa2 A T 1: 158,936,554 D462E probably benign Het
Pcdh12 A T 18: 38,283,443 F210I probably damaging Het
Ppp1r12c A G 7: 4,484,444 probably null Het
Ptprb C A 10: 116,339,679 T1193K probably damaging Het
Qrfpr T A 3: 36,182,660 E197D possibly damaging Het
Rusc2 T A 4: 43,416,568 C625S probably benign Het
Shcbp1 T G 8: 4,741,968 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spag5 T A 11: 78,305,317 C449* probably null Het
Stpg3 T C 2: 25,213,850 D158G probably damaging Het
Sycp2 T C 2: 178,347,797 Y1423C probably benign Het
Tiprl C T 1: 165,215,790 E256K possibly damaging Het
Tmem132c T A 5: 127,563,567 V934D probably damaging Het
Topors A G 4: 40,261,982 V434A probably benign Het
Usp11 A G X: 20,718,707 Y731C probably damaging Het
Vmn2r58 T A 7: 41,863,963 I419L probably benign Het
Wfs1 C A 5: 36,982,078 R72L possibly damaging Het
Zan T C 5: 137,427,939 D2525G unknown Het
Zfp280c A G X: 48,563,838 V285A probably benign Het
Zfp511 T A 7: 140,037,615 F177I probably damaging Het
Zfp964 A G 8: 69,663,070 M107V unknown Het
Zmynd11 A G 13: 9,710,220 Y122H probably damaging Het
Other mutations in Prkce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Prkce APN 17 86625462 missense probably damaging 0.99
IGL01401:Prkce APN 17 86168840 missense probably damaging 1.00
IGL01508:Prkce APN 17 86630085 missense probably damaging 1.00
IGL02500:Prkce APN 17 86168914 missense probably benign 0.16
IGL02957:Prkce APN 17 86496026 missense possibly damaging 0.74
IGL03114:Prkce APN 17 86654555 missense probably damaging 0.97
Pinnacles UTSW 17 86476851 missense probably damaging 1.00
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0403:Prkce UTSW 17 86168653 missense probably damaging 0.98
R0900:Prkce UTSW 17 86625458 missense probably damaging 1.00
R0919:Prkce UTSW 17 86630160 missense probably benign 0.06
R1430:Prkce UTSW 17 86559137 splice site probably benign
R1843:Prkce UTSW 17 86475546 nonsense probably null
R2129:Prkce UTSW 17 86496035 missense possibly damaging 0.89
R2341:Prkce UTSW 17 86474442 missense probably damaging 1.00
R2511:Prkce UTSW 17 86625326 missense probably damaging 1.00
R2679:Prkce UTSW 17 86176226 intron probably benign
R3724:Prkce UTSW 17 86168623 nonsense probably null
R3853:Prkce UTSW 17 86168849 missense probably damaging 1.00
R4364:Prkce UTSW 17 86476851 missense probably damaging 1.00
R4467:Prkce UTSW 17 86619911 missense possibly damaging 0.68
R4523:Prkce UTSW 17 86490750 critical splice acceptor site probably null
R4838:Prkce UTSW 17 86630083 missense probably benign 0.07
R5140:Prkce UTSW 17 86482142 missense probably benign 0.12
R5579:Prkce UTSW 17 86619948 missense probably damaging 1.00
R6026:Prkce UTSW 17 86493230 missense probably benign 0.02
R6048:Prkce UTSW 17 86493347 missense probably benign
R6212:Prkce UTSW 17 86559301 missense probably damaging 1.00
R6484:Prkce UTSW 17 86490809 missense probably benign
R6788:Prkce UTSW 17 86630061 missense probably damaging 1.00
R6915:Prkce UTSW 17 86493407 missense probably damaging 1.00
R7349:Prkce UTSW 17 86493355 missense probably benign
R7447:Prkce UTSW 17 86559259 missense probably damaging 1.00
R7566:Prkce UTSW 17 86493329 missense probably benign 0.00
R7577:Prkce UTSW 17 86493293 nonsense probably null
R7638:Prkce UTSW 17 86168600 missense probably benign 0.26
RF010:Prkce UTSW 17 86488199 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTTACCTGAGCACTGTGCCAGAG -3'
(R):5'- CGCAGACGGTCAAAAGTGGTTTC -3'

Sequencing Primer
(F):5'- AAAACCCCTTAGGTAGTTTCCC -3'
(R):5'- ACGGTCAAAAGTGGTTTCTGATAG -3'
Posted On2014-03-14