Mutagenetix > Incidental Mutations

Incidental Mutation 'R1413:Pcdh12'

159727

Institutional Source

Beutler Lab

Gene Symbol

Pcdh12

Ensembl Gene

ENSMUSG00000024440

Gene Name

protocadherin 12

Synonyms

VE-cadherin-2, vascular endothelial cadherin-2

MMRRC Submission

039469-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1413 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38267092-38284402 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38283443 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 210 (F210I)

Ref Sequence

ENSEMBL: ENSMUSP00000025311 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025311] [ENSMUST00000194012]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025311
AA Change: F210I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025311
Gene: ENSMUSG00000024440
AA Change: F210I

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
CA	53	133	4.42e-2	SMART
CA	157	242	2.55e-17	SMART
CA	266	350	2.31e-24	SMART
CA	376	458	3.86e-26	SMART
CA	482	563	6.27e-26	SMART
CA	621	704	3.02e-2	SMART
transmembrane domain	716	738	N/A	INTRINSIC
low complexity region	960	975	N/A	INTRINSIC
low complexity region	1032	1041	N/A	INTRINSIC
low complexity region	1115	1125	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193123

Predicted Effect

probably benign
Transcript: ENSMUST00000194012

SMART Domains

Protein: ENSMUSP00000141907
Gene: ENSMUSG00000024440

Domain	Start	End	E-Value	Type
low complexity region	56	66	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.7%
20x: 91.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are viable, fertile and do not display any obvious histomorphological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	A	G	6: 142,590,496	V1504A	probably damaging	Het
Abcc9	T	C	6: 142,627,519	N1051D	possibly damaging	Het
Actr6	A	T	10: 89,728,157	Y84*	probably null	Het
Adgrl3	T	C	5: 81,693,519	Y816H	probably damaging	Het
Ahcyl2	T	C	6: 29,768,587		probably benign	Het
Amd1	A	T	10: 40,290,408	C157*	probably null	Het
Ank1	G	A	8: 23,119,377	E1362K	probably damaging	Het
Atp10b	A	G	11: 43,230,564	Q1018R	probably benign	Het
Atp1a2	G	A	1: 172,279,344	T803I	probably damaging	Het
Atr	T	G	9: 95,932,442	L2064R	probably damaging	Het
Bmp3	T	A	5: 98,872,405	L229Q	probably damaging	Het
Ccl25	A	G	8: 4,353,892	*54W	probably null	Het
Cdc45	A	T	16: 18,808,741	N111K	possibly damaging	Het
Cfap61	T	A	2: 145,963,443	S154T	probably benign	Het
Cyp2c37	T	A	19: 39,994,098	S127T	probably benign	Het
Cyp4f40	T	A	17: 32,673,939	D309E	probably benign	Het
D6Ertd527e	A	G	6: 87,111,353	D166G	unknown	Het
Dmbt1	T	A	7: 131,050,214	D395E	probably damaging	Het
Dnah5	A	G	15: 28,370,409	S2832G	probably benign	Het
Dync1h1	G	A	12: 110,636,509	E2195K	probably benign	Het
Fah	T	C	7: 84,593,212	D296G	probably damaging	Het
Fam83g	A	G	11: 61,702,678	N346S	probably damaging	Het
Fgl1	T	A	8: 41,191,601	T289S	possibly damaging	Het
Fmo1	A	C	1: 162,833,862	L284R	probably damaging	Het
Frem3	T	A	8: 80,668,801	M1819K	probably benign	Het
Fsip2	T	A	2: 82,988,418	L4832M	possibly damaging	Het
Fut1	T	C	7: 45,619,428	W269R	probably damaging	Het
Ggnbp2	A	G	11: 84,833,129	Y638H	probably damaging	Het
Gp2	T	A	7: 119,451,630	I293F	probably benign	Het
Gpi1	T	C	7: 34,230,155	N20S	probably benign	Het
Gxylt1	C	T	15: 93,254,392	R222H	probably damaging	Het
Hemgn	T	C	4: 46,396,091	K382E	possibly damaging	Het
Hook3	T	A	8: 26,038,106	E585D	probably damaging	Het
Irf6	G	A	1: 193,169,305	M401I	probably benign	Het
Jmjd1c	A	G	10: 67,249,750	T2259A	probably damaging	Het
Lactb	T	A	9: 66,970,919	R209S	probably damaging	Het
Lonp2	A	G	8: 86,641,584	D342G	probably damaging	Het
Mmachc	T	C	4: 116,705,997	S54G	probably damaging	Het
Mpp7	C	A	18: 7,350,977	W573C	probably damaging	Het
Olfr1133	T	A	2: 87,645,838	Y95F	probably benign	Het
Olfr1415	A	T	1: 92,490,888	I289N	probably damaging	Het
Olfr70	T	A	4: 43,697,011	H54L	possibly damaging	Het
Pappa2	A	T	1: 158,936,554	D462E	probably benign	Het
Ppp1r12c	A	G	7: 4,484,444		probably null	Het
Prkce	T	A	17: 86,496,018	D448E	possibly damaging	Het
Ptprb	C	A	10: 116,339,679	T1193K	probably damaging	Het
Qrfpr	T	A	3: 36,182,660	E197D	possibly damaging	Het
Rusc2	T	A	4: 43,416,568	C625S	probably benign	Het
Shcbp1	T	G	8: 4,741,968		probably null	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spag5	T	A	11: 78,305,317	C449*	probably null	Het
Stpg3	T	C	2: 25,213,850	D158G	probably damaging	Het
Sycp2	T	C	2: 178,347,797	Y1423C	probably benign	Het
Tiprl	C	T	1: 165,215,790	E256K	possibly damaging	Het
Tmem132c	T	A	5: 127,563,567	V934D	probably damaging	Het
Topors	A	G	4: 40,261,982	V434A	probably benign	Het
Usp11	A	G	X: 20,718,707	Y731C	probably damaging	Het
Vmn2r58	T	A	7: 41,863,963	I419L	probably benign	Het
Wfs1	C	A	5: 36,982,078	R72L	possibly damaging	Het
Zan	T	C	5: 137,427,939	D2525G	unknown	Het
Zfp280c	A	G	X: 48,563,838	V285A	probably benign	Het
Zfp511	T	A	7: 140,037,615	F177I	probably damaging	Het
Zfp964	A	G	8: 69,663,070	M107V	unknown	Het
Zmynd11	A	G	13: 9,710,220	Y122H	probably damaging	Het

Other mutations in Pcdh12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Pcdh12	APN	18	38281457	missense	probably benign
IGL00964:Pcdh12	APN	18	38282731	missense	probably benign	0.27
IGL01105:Pcdh12	APN	18	38275347	missense	probably damaging	1.00
IGL02011:Pcdh12	APN	18	38281420	missense	probably damaging	1.00
IGL02234:Pcdh12	APN	18	38283535	missense	probably damaging	1.00
IGL02452:Pcdh12	APN	18	38281693	missense	probably benign	0.00
IGL03412:Pcdh12	APN	18	38283515	missense	probably benign	0.24
R0729:Pcdh12	UTSW	18	38282464	missense	probably benign	0.20
R1330:Pcdh12	UTSW	18	38281861	missense	probably benign	0.13
R1394:Pcdh12	UTSW	18	38281189	critical splice donor site	probably null
R1993:Pcdh12	UTSW	18	38282143	missense	possibly damaging	0.62
R2115:Pcdh12	UTSW	18	38283986	missense	probably damaging	1.00
R2567:Pcdh12	UTSW	18	38282096	missense	probably damaging	1.00
R2926:Pcdh12	UTSW	18	38282390	missense	probably damaging	0.99
R3810:Pcdh12	UTSW	18	38281237	missense	probably damaging	1.00
R3813:Pcdh12	UTSW	18	38283614	nonsense	probably null
R5275:Pcdh12	UTSW	18	38284101	utr 5 prime	probably benign
R5400:Pcdh12	UTSW	18	38268898	missense	probably damaging	1.00
R5523:Pcdh12	UTSW	18	38283139	missense	probably damaging	1.00
R5539:Pcdh12	UTSW	18	38281744	missense	possibly damaging	0.77
R5604:Pcdh12	UTSW	18	38268882	missense	probably damaging	1.00
R6012:Pcdh12	UTSW	18	38283752	missense	probably damaging	1.00
R6042:Pcdh12	UTSW	18	38281505	missense	probably damaging	1.00
R6129:Pcdh12	UTSW	18	38277859	missense	probably damaging	1.00
R6239:Pcdh12	UTSW	18	38282401	missense	probably damaging	1.00
R6508:Pcdh12	UTSW	18	38281337	nonsense	probably null
R7250:Pcdh12	UTSW	18	38281976	missense	probably benign
R7259:Pcdh12	UTSW	18	38281624	missense	probably benign	0.00
R7271:Pcdh12	UTSW	18	38283047	missense	probably damaging	1.00
R7489:Pcdh12	UTSW	18	38281789	missense	possibly damaging	0.77
Z1177:Pcdh12	UTSW	18	38282992	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGACACATGCTTGCCAAAGAAGAAC -3'
(R):5'- TGCCTCTCTGCACACACGAATC -3'

Sequencing Primer
(F):5'- CGGGATCTGTAGCAGTCAG -3'
(R):5'- CGAATCCCCTTGGACAGAG -3'

Posted On

2014-03-14