Incidental Mutation 'R1413:Usp11'
ID159729
Institutional Source Beutler Lab
Gene Symbol Usp11
Ensembl Gene ENSMUSG00000031066
Gene Nameubiquitin specific peptidase 11
Synonyms
MMRRC Submission 039469-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1413 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location20703906-20720539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20718707 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 731 (Y731C)
Ref Sequence ENSEMBL: ENSMUSP00000033383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033383]
Predicted Effect probably damaging
Transcript: ENSMUST00000033383
AA Change: Y731C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033383
Gene: ENSMUSG00000031066
AA Change: Y731C

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
DUSP 44 136 1.37e-36 SMART
Pfam:Ubiquitin_3 146 234 5.6e-14 PFAM
Pfam:UCH 256 886 5.1e-83 PFAM
Pfam:UCH_1 257 448 1.6e-7 PFAM
Pfam:UCH_1 658 868 2.9e-13 PFAM
low complexity region 898 915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149960
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. This gene encodes a deubiquitinating enzyme which lies in a gene cluster on chromosome Xp11.23 [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,590,496 V1504A probably damaging Het
Abcc9 T C 6: 142,627,519 N1051D possibly damaging Het
Actr6 A T 10: 89,728,157 Y84* probably null Het
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,587 probably benign Het
Amd1 A T 10: 40,290,408 C157* probably null Het
Ank1 G A 8: 23,119,377 E1362K probably damaging Het
Atp10b A G 11: 43,230,564 Q1018R probably benign Het
Atp1a2 G A 1: 172,279,344 T803I probably damaging Het
Atr T G 9: 95,932,442 L2064R probably damaging Het
Bmp3 T A 5: 98,872,405 L229Q probably damaging Het
Ccl25 A G 8: 4,353,892 *54W probably null Het
Cdc45 A T 16: 18,808,741 N111K possibly damaging Het
Cfap61 T A 2: 145,963,443 S154T probably benign Het
Cyp2c37 T A 19: 39,994,098 S127T probably benign Het
Cyp4f40 T A 17: 32,673,939 D309E probably benign Het
D6Ertd527e A G 6: 87,111,353 D166G unknown Het
Dmbt1 T A 7: 131,050,214 D395E probably damaging Het
Dnah5 A G 15: 28,370,409 S2832G probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fah T C 7: 84,593,212 D296G probably damaging Het
Fam83g A G 11: 61,702,678 N346S probably damaging Het
Fgl1 T A 8: 41,191,601 T289S possibly damaging Het
Fmo1 A C 1: 162,833,862 L284R probably damaging Het
Frem3 T A 8: 80,668,801 M1819K probably benign Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Fut1 T C 7: 45,619,428 W269R probably damaging Het
Ggnbp2 A G 11: 84,833,129 Y638H probably damaging Het
Gp2 T A 7: 119,451,630 I293F probably benign Het
Gpi1 T C 7: 34,230,155 N20S probably benign Het
Gxylt1 C T 15: 93,254,392 R222H probably damaging Het
Hemgn T C 4: 46,396,091 K382E possibly damaging Het
Hook3 T A 8: 26,038,106 E585D probably damaging Het
Irf6 G A 1: 193,169,305 M401I probably benign Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Lactb T A 9: 66,970,919 R209S probably damaging Het
Lonp2 A G 8: 86,641,584 D342G probably damaging Het
Mmachc T C 4: 116,705,997 S54G probably damaging Het
Mpp7 C A 18: 7,350,977 W573C probably damaging Het
Olfr1133 T A 2: 87,645,838 Y95F probably benign Het
Olfr1415 A T 1: 92,490,888 I289N probably damaging Het
Olfr70 T A 4: 43,697,011 H54L possibly damaging Het
Pappa2 A T 1: 158,936,554 D462E probably benign Het
Pcdh12 A T 18: 38,283,443 F210I probably damaging Het
Ppp1r12c A G 7: 4,484,444 probably null Het
Prkce T A 17: 86,496,018 D448E possibly damaging Het
Ptprb C A 10: 116,339,679 T1193K probably damaging Het
Qrfpr T A 3: 36,182,660 E197D possibly damaging Het
Rusc2 T A 4: 43,416,568 C625S probably benign Het
Shcbp1 T G 8: 4,741,968 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spag5 T A 11: 78,305,317 C449* probably null Het
Stpg3 T C 2: 25,213,850 D158G probably damaging Het
Sycp2 T C 2: 178,347,797 Y1423C probably benign Het
Tiprl C T 1: 165,215,790 E256K possibly damaging Het
Tmem132c T A 5: 127,563,567 V934D probably damaging Het
Topors A G 4: 40,261,982 V434A probably benign Het
Vmn2r58 T A 7: 41,863,963 I419L probably benign Het
Wfs1 C A 5: 36,982,078 R72L possibly damaging Het
Zan T C 5: 137,427,939 D2525G unknown Het
Zfp280c A G X: 48,563,838 V285A probably benign Het
Zfp511 T A 7: 140,037,615 F177I probably damaging Het
Zfp964 A G 8: 69,663,070 M107V unknown Het
Zmynd11 A G 13: 9,710,220 Y122H probably damaging Het
Other mutations in Usp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02037:Usp11 APN X 20719142 missense probably damaging 1.00
IGL02093:Usp11 APN X 20719352 missense probably benign 0.09
IGL02583:Usp11 APN X 20718045 missense probably benign 0.01
IGL03194:Usp11 APN X 20712417 missense probably benign 0.00
R2926:Usp11 UTSW X 20717792 missense probably damaging 0.99
R3607:Usp11 UTSW X 20714632 missense probably damaging 1.00
X0028:Usp11 UTSW X 20712090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTAGCAACAGGAGCATAACCG -3'
(R):5'- AGGGACAGAATCCAGCCTCATCTAC -3'

Sequencing Primer
(F):5'- GAGACCCTTGTAGCTCACACTG -3'
(R):5'- GCCTACAAAGGTTCATTCTCAG -3'
Posted On2014-03-14