Incidental Mutation 'R1414:Hspa9'
ID 159759
Institutional Source Beutler Lab
Gene Symbol Hspa9
Ensembl Gene ENSMUSG00000024359
Gene Name heat shock protein 9
Synonyms C3H-specific antigen, mthsp70, GRP75, PBP74, CSA, Hsc74, mot-2, Hsp74a, Hspa9a, Hsp74, mortalin
MMRRC Submission 039470-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock # R1414 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 34937414-34954357 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34938591 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 652 (Y652C)
Ref Sequence ENSEMBL: ENSMUSP00000025217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025217]
AlphaFold P38647
Predicted Effect probably damaging
Transcript: ENSMUST00000025217
AA Change: Y652C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025217
Gene: ENSMUSG00000024359
AA Change: Y652C

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
Pfam:HSP70 55 653 2.7e-270 PFAM
Pfam:FGGY_C 283 429 3e-8 PFAM
low complexity region 657 679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173701
Meta Mutation Damage Score 0.7387 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality while heterozygotes display decreased pre-B cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap1 T A 15: 64,158,884 S315C possibly damaging Het
Cdc27 A G 11: 104,521,425 V452A probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dnajc10 C A 2: 80,347,677 T676K probably damaging Het
Efhc1 C T 1: 20,961,289 T237I probably damaging Het
Fam19a4 A G 6: 97,014,479 V3A probably benign Het
Fn1 A G 1: 71,601,303 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hfm1 T C 5: 106,872,353 D1069G probably benign Het
Lrfn2 A G 17: 49,070,829 I313V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mxra8 A G 4: 155,841,007 M58V probably damaging Het
Myh3 A G 11: 67,098,665 E1537G probably damaging Het
Nlrp3 A G 11: 59,549,531 M645V probably benign Het
Nlrp4d T A 7: 10,382,601 I118F probably benign Het
Oas1f A G 5: 120,851,459 probably benign Het
Pkp1 A G 1: 135,884,085 probably benign Het
Plcb3 T C 19: 6,963,017 Y428C probably damaging Het
Pomt1 C A 2: 32,243,610 probably benign Het
Prex1 G A 2: 166,593,861 R589C probably damaging Het
Prr5 C T 15: 84,699,711 Q171* probably null Het
Ptar1 T A 19: 23,720,291 L389Q possibly damaging Het
Rufy2 T A 10: 63,002,199 L375* probably null Het
Slc22a1 G A 17: 12,662,600 S334L probably damaging Het
Slc34a1 T C 13: 55,400,711 S45P probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tnc A G 4: 63,965,695 probably benign Het
Tpm3-rs7 T C 14: 113,314,842 I56T possibly damaging Het
Zbtb11 T A 16: 55,990,560 C360* probably null Het
Zfp263 T C 16: 3,749,296 C204R probably damaging Het
Other mutations in Hspa9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Hspa9 APN 18 34938580 splice site probably benign
IGL01939:Hspa9 APN 18 34938708 missense possibly damaging 0.89
IGL02008:Hspa9 APN 18 34947975 nonsense probably null
IGL02604:Hspa9 APN 18 34954213 missense unknown
Chiri-san UTSW 18 34939423 missense probably damaging 1.00
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0238:Hspa9 UTSW 18 34946646 nonsense probably null
R0278:Hspa9 UTSW 18 34940910 missense possibly damaging 0.50
R0613:Hspa9 UTSW 18 34947980 missense probably damaging 1.00
R1454:Hspa9 UTSW 18 34938606 missense probably damaging 1.00
R2013:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2014:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2015:Hspa9 UTSW 18 34946648 missense probably damaging 1.00
R2936:Hspa9 UTSW 18 34948014 missense probably damaging 1.00
R4261:Hspa9 UTSW 18 34939423 missense probably damaging 1.00
R4622:Hspa9 UTSW 18 34949037 missense possibly damaging 0.48
R4819:Hspa9 UTSW 18 34939388 missense probably damaging 0.98
R5056:Hspa9 UTSW 18 34938681 missense probably damaging 1.00
R5223:Hspa9 UTSW 18 34952671 splice site probably null
R5666:Hspa9 UTSW 18 34954247 missense probably null
R5820:Hspa9 UTSW 18 34943174 missense possibly damaging 0.82
R5944:Hspa9 UTSW 18 34949023 missense possibly damaging 0.94
R6460:Hspa9 UTSW 18 34952712 missense probably benign
R7404:Hspa9 UTSW 18 34943276 missense possibly damaging 0.76
R7412:Hspa9 UTSW 18 34949029 missense probably damaging 1.00
R7637:Hspa9 UTSW 18 34938687 missense not run
R8524:Hspa9 UTSW 18 34954244 missense unknown
R8830:Hspa9 UTSW 18 34948104 critical splice donor site probably null
R8987:Hspa9 UTSW 18 34947929 missense probably damaging 1.00
R9028:Hspa9 UTSW 18 34942031 missense probably damaging 1.00
R9184:Hspa9 UTSW 18 34949115 missense possibly damaging 0.87
Z1177:Hspa9 UTSW 18 34943145 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGCCAGAACTTCCAGAACCTTCC -3'
(R):5'- AAGGACCAGTTGCCTGCTGATG -3'

Sequencing Primer
(F):5'- AGAACCTTCCCGTTCAGATG -3'
(R):5'- GCCTGCTGATGAGGTAACAATTC -3'
Posted On 2014-03-14