Incidental Mutation 'R1414:Ptar1'
ID159762
Institutional Source Beutler Lab
Gene Symbol Ptar1
Ensembl Gene ENSMUSG00000074925
Gene Nameprotein prenyltransferase alpha subunit repeat containing 1
Synonyms
MMRRC Submission 039470-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R1414 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23687400-23721129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23720291 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 389 (L389Q)
Ref Sequence ENSEMBL: ENSMUSP00000097156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067077] [ENSMUST00000099560]
Predicted Effect probably benign
Transcript: ENSMUST00000067077
Predicted Effect possibly damaging
Transcript: ENSMUST00000099560
AA Change: L389Q

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097156
Gene: ENSMUSG00000074925
AA Change: L389Q

DomainStartEndE-ValueType
Pfam:PPTA 122 149 3.9e-8 PFAM
Pfam:PPTA 180 207 5e-11 PFAM
Pfam:PPTA 290 315 8e-9 PFAM
Meta Mutation Damage Score 0.0886 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.2%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap1 T A 15: 64,158,884 S315C possibly damaging Het
Cdc27 A G 11: 104,521,425 V452A probably benign Het
Cndp1 G A 18: 84,634,652 probably benign Het
Dnajc10 C A 2: 80,347,677 T676K probably damaging Het
Efhc1 C T 1: 20,961,289 T237I probably damaging Het
Fam19a4 A G 6: 97,014,479 V3A probably benign Het
Fn1 A G 1: 71,601,303 probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hfm1 T C 5: 106,872,353 D1069G probably benign Het
Hspa9 T C 18: 34,938,591 Y652C probably damaging Het
Lrfn2 A G 17: 49,070,829 I313V probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mxra8 A G 4: 155,841,007 M58V probably damaging Het
Myh3 A G 11: 67,098,665 E1537G probably damaging Het
Nlrp3 A G 11: 59,549,531 M645V probably benign Het
Nlrp4d T A 7: 10,382,601 I118F probably benign Het
Oas1f A G 5: 120,851,459 probably benign Het
Pkp1 A G 1: 135,884,085 probably benign Het
Plcb3 T C 19: 6,963,017 Y428C probably damaging Het
Pomt1 C A 2: 32,243,610 probably benign Het
Prex1 G A 2: 166,593,861 R589C probably damaging Het
Prr5 C T 15: 84,699,711 Q171* probably null Het
Rufy2 T A 10: 63,002,199 L375* probably null Het
Slc22a1 G A 17: 12,662,600 S334L probably damaging Het
Slc34a1 T C 13: 55,400,711 S45P probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Tnc A G 4: 63,965,695 probably benign Het
Tpm3-rs7 T C 14: 113,314,842 I56T possibly damaging Het
Zbtb11 T A 16: 55,990,560 C360* probably null Het
Zfp263 T C 16: 3,749,296 C204R probably damaging Het
Other mutations in Ptar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Ptar1 APN 19 23705801 missense probably damaging 1.00
IGL02608:Ptar1 APN 19 23705712 missense possibly damaging 0.48
R0134:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R0225:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R0395:Ptar1 UTSW 19 23720199 missense probably damaging 1.00
R0551:Ptar1 UTSW 19 23720340 missense probably benign 0.32
R3114:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R4016:Ptar1 UTSW 19 23687460 start codon destroyed probably null 0.99
R4431:Ptar1 UTSW 19 23694331 missense probably damaging 1.00
R4897:Ptar1 UTSW 19 23703108 missense probably damaging 1.00
R5054:Ptar1 UTSW 19 23694365 missense probably damaging 1.00
R5660:Ptar1 UTSW 19 23694412 missense probably benign 0.32
R5928:Ptar1 UTSW 19 23717913 missense probably benign 0.00
R6333:Ptar1 UTSW 19 23694322 missense possibly damaging 0.65
R6610:Ptar1 UTSW 19 23717844 missense probably benign 0.01
R6834:Ptar1 UTSW 19 23717924 missense probably benign
R6915:Ptar1 UTSW 19 23703137 missense probably damaging 1.00
R7381:Ptar1 UTSW 19 23708970 splice site probably null
R7424:Ptar1 UTSW 19 23718101 missense probably damaging 1.00
R7563:Ptar1 UTSW 19 23720316 missense probably benign 0.00
R7884:Ptar1 UTSW 19 23708794 missense probably benign 0.03
R7967:Ptar1 UTSW 19 23708794 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CATCACTTAAATGGCAGGCTCCCTC -3'
(R):5'- AGTCAGTCCATGCAACTATGGCAC -3'

Sequencing Primer
(F):5'- AGGCTCCCTCCCAACCTG -3'
(R):5'- CATGCAACTATGGCACTGAGAAAG -3'
Posted On2014-03-14