Incidental Mutation 'R1415:Slc30a2'
ID159769
Institutional Source Beutler Lab
Gene Symbol Slc30a2
Ensembl Gene ENSMUSG00000028836
Gene Namesolute carrier family 30 (zinc transporter), member 2
SynonymsZnt2
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R1415 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134343181-134354484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134349349 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 265 (T265M)
Ref Sequence ENSEMBL: ENSMUSP00000101500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081094] [ENSMUST00000105872] [ENSMUST00000105873] [ENSMUST00000105874]
Predicted Effect probably damaging
Transcript: ENSMUST00000081094
AA Change: T185M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079875
Gene: ENSMUSG00000028836
AA Change: T185M

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105872
AA Change: T185M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101498
Gene: ENSMUSG00000028836
AA Change: T185M

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105873
AA Change: T216M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101499
Gene: ENSMUSG00000028836
AA Change: T216M

DomainStartEndE-ValueType
Pfam:Cation_efflux 74 311 3.1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105874
AA Change: T265M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101500
Gene: ENSMUSG00000028836
AA Change: T265M

DomainStartEndE-ValueType
Pfam:Cation_efflux 70 277 3.4e-51 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc transporter that acts as a homodimer. The encoded protein plays a role in secreting zinc into breast milk. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Ccdc71 T A 9: 108,463,208 Y73* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Dnajb11 T C 16: 22,870,621 V264A probably benign Het
Fam135b T C 15: 71,456,928 E1174G probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Gigyf1 A G 5: 137,519,216 probably null Het
Gm38394 C T 1: 133,657,818 V594M possibly damaging Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr462 A C 11: 87,889,647 V83G possibly damaging Het
Olfr667 A G 7: 104,916,336 I320T probably benign Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Secisbp2l C A 2: 125,740,365 G1057V probably benign Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tmem26 T C 10: 68,778,661 F302S possibly damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Slc30a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Slc30a2 APN 4 134343300 missense probably damaging 0.96
IGL01822:Slc30a2 APN 4 134348637 missense probably damaging 0.98
IGL02808:Slc30a2 APN 4 134344049 missense possibly damaging 0.65
R2279:Slc30a2 UTSW 4 134348546 missense probably benign
R4151:Slc30a2 UTSW 4 134344048 missense probably benign 0.00
R4278:Slc30a2 UTSW 4 134346049 missense probably null 1.00
R4783:Slc30a2 UTSW 4 134344006 critical splice acceptor site probably null
R5823:Slc30a2 UTSW 4 134345978 missense probably damaging 0.98
R7017:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7018:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7021:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7034:Slc30a2 UTSW 4 134347342 missense possibly damaging 0.80
R7053:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7056:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7057:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7067:Slc30a2 UTSW 4 134344218 critical splice donor site probably null
R7138:Slc30a2 UTSW 4 134344118 missense probably benign 0.00
R7275:Slc30a2 UTSW 4 134349270 splice site probably null
R7289:Slc30a2 UTSW 4 134344213 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CATCACACAGGCAGTGGGATGTAG -3'
(R):5'- ACCCTGGTGGCAAACTCTGGTTTC -3'

Sequencing Primer
(F):5'- tcaccgaacctcagttttcc -3'
(R):5'- TGGTTTCTACACACAACCTAAGGG -3'
Posted On2014-03-14