Incidental Mutation 'R1415:Fam83e'
ID159773
Institutional Source Beutler Lab
Gene Symbol Fam83e
Ensembl Gene ENSMUSG00000054161
Gene Namefamily with sequence similarity 83, member E
Synonyms4930403C10Rik
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1415 (G1)
Quality Score213
Status Not validated
Chromosome7
Chromosomal Location45721212-45729492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45726711 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 283 (E283K)
Ref Sequence ENSEMBL: ENSMUSP00000114397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075571] [ENSMUST00000094424] [ENSMUST00000129507] [ENSMUST00000209739] [ENSMUST00000210754]
Predicted Effect probably benign
Transcript: ENSMUST00000075571
SMART Domains Protein: ENSMUSP00000075005
Gene: ENSMUSG00000003271

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 57 302 7.8e-84 PFAM
low complexity region 309 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094424
SMART Domains Protein: ENSMUSP00000091991
Gene: ENSMUSG00000070563

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:UPAR_LY6 23 97 1.7e-7 PFAM
low complexity region 99 123 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129507
AA Change: E283K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114397
Gene: ENSMUSG00000054161
AA Change: E283K

DomainStartEndE-ValueType
Pfam:DUF1669 18 293 4.8e-105 PFAM
low complexity region 371 385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146391
AA Change: G45E
Predicted Effect probably benign
Transcript: ENSMUST00000209739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210434
Predicted Effect probably benign
Transcript: ENSMUST00000210754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211124
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Ccdc71 T A 9: 108,463,208 Y73* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Dnajb11 T C 16: 22,870,621 V264A probably benign Het
Fam135b T C 15: 71,456,928 E1174G probably damaging Het
Gigyf1 A G 5: 137,519,216 probably null Het
Gm38394 C T 1: 133,657,818 V594M possibly damaging Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr462 A C 11: 87,889,647 V83G possibly damaging Het
Olfr667 A G 7: 104,916,336 I320T probably benign Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Secisbp2l C A 2: 125,740,365 G1057V probably benign Het
Slc30a2 C T 4: 134,349,349 T265M probably damaging Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tmem26 T C 10: 68,778,661 F302S possibly damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Fam83e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fam83e APN 7 45727069 missense probably benign 0.12
IGL01590:Fam83e APN 7 45723936 missense probably null 1.00
IGL02334:Fam83e APN 7 45723921 missense probably benign 0.00
IGL03155:Fam83e APN 7 45727075 missense possibly damaging 0.90
IGL03276:Fam83e APN 7 45723460 missense possibly damaging 0.72
R0268:Fam83e UTSW 7 45726910 missense probably benign
R0362:Fam83e UTSW 7 45726969 missense probably benign 0.40
R0453:Fam83e UTSW 7 45723948 missense probably damaging 1.00
R0832:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R0870:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R0871:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1574:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1574:Fam83e UTSW 7 45726711 missense probably damaging 1.00
R1656:Fam83e UTSW 7 45722263 missense probably benign
R1848:Fam83e UTSW 7 45728769 nonsense probably null
R1848:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R2189:Fam83e UTSW 7 45722183 start codon destroyed probably null 0.88
R2256:Fam83e UTSW 7 45728769 nonsense probably null
R2256:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R2257:Fam83e UTSW 7 45728769 nonsense probably null
R2257:Fam83e UTSW 7 45728770 missense possibly damaging 0.79
R4376:Fam83e UTSW 7 45723893 missense probably damaging 1.00
R4600:Fam83e UTSW 7 45723500 missense probably benign 0.01
R5876:Fam83e UTSW 7 45722363 unclassified probably null
R6666:Fam83e UTSW 7 45727002 missense probably benign
R6766:Fam83e UTSW 7 45726646 missense probably damaging 1.00
R6781:Fam83e UTSW 7 45722147 unclassified probably benign
R6933:Fam83e UTSW 7 45722394 missense probably benign
R7320:Fam83e UTSW 7 45722472 missense probably benign 0.16
R7477:Fam83e UTSW 7 45728980 missense probably damaging 1.00
R7636:Fam83e UTSW 7 45727026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCTCTTCACCAACGGAGCTG -3'
(R):5'- CGCTGTACACTCCTCAAGATGTCAC -3'

Sequencing Primer
(F):5'- CTGAGCCCTGTGAGATCATGTC -3'
(R):5'- CCTCAAGATGTCACTGAGAGCTG -3'
Posted On2014-03-14