Incidental Mutation 'R1415:Ccdc71'
ID159777
Institutional Source Beutler Lab
Gene Symbol Ccdc71
Ensembl Gene ENSMUSG00000049305
Gene Namecoiled-coil domain containing 71
Synonyms2600016J21Rik
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R1415 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108460527-108465938 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 108463208 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 73 (Y73*)
Ref Sequence ENSEMBL: ENSMUSP00000141937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061209] [ENSMUST00000193170] [ENSMUST00000193269] [ENSMUST00000193286] [ENSMUST00000193895]
Predicted Effect probably null
Transcript: ENSMUST00000061209
AA Change: Y73*
SMART Domains Protein: ENSMUSP00000057891
Gene: ENSMUSG00000049305
AA Change: Y73*

DomainStartEndE-ValueType
Pfam:CCDC71L 8 430 4.7e-168 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192210
Predicted Effect probably null
Transcript: ENSMUST00000193170
AA Change: Y73*
SMART Domains Protein: ENSMUSP00000142230
Gene: ENSMUSG00000049305
AA Change: Y73*

DomainStartEndE-ValueType
Pfam:CCDC71L 8 430 3.1e-151 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000193269
AA Change: Y73*
SMART Domains Protein: ENSMUSP00000141937
Gene: ENSMUSG00000049305
AA Change: Y73*

DomainStartEndE-ValueType
Pfam:CCDC71L 8 93 5.3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193286
SMART Domains Protein: ENSMUSP00000142325
Gene: ENSMUSG00000032609

DomainStartEndE-ValueType
Kelch 32 79 2.08e-6 SMART
Kelch 80 127 1.9e-1 SMART
Kelch 128 174 1.76e-4 SMART
Kelch 176 222 3.74e-8 SMART
Kelch 239 281 8.33e0 SMART
Kelch 282 329 3.83e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193618
Predicted Effect probably benign
Transcript: ENSMUST00000193895
SMART Domains Protein: ENSMUSP00000141453
Gene: ENSMUSG00000032609

DomainStartEndE-ValueType
Kelch 32 79 2.08e-6 SMART
Kelch 80 127 1.9e-1 SMART
Kelch 128 174 1.76e-4 SMART
Kelch 176 222 3.74e-8 SMART
Kelch 239 281 8.33e0 SMART
Kelch 282 329 3.83e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195869
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Dnajb11 T C 16: 22,870,621 V264A probably benign Het
Fam135b T C 15: 71,456,928 E1174G probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Gigyf1 A G 5: 137,519,216 probably null Het
Gm38394 C T 1: 133,657,818 V594M possibly damaging Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr462 A C 11: 87,889,647 V83G possibly damaging Het
Olfr667 A G 7: 104,916,336 I320T probably benign Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Secisbp2l C A 2: 125,740,365 G1057V probably benign Het
Slc30a2 C T 4: 134,349,349 T265M probably damaging Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tmem26 T C 10: 68,778,661 F302S possibly damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Ccdc71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ccdc71 APN 9 108463038 missense probably damaging 1.00
IGL00428:Ccdc71 APN 9 108464155 missense probably damaging 1.00
R0158:Ccdc71 UTSW 9 108464137 missense probably benign 0.01
R1328:Ccdc71 UTSW 9 108462949 unclassified probably benign
R4721:Ccdc71 UTSW 9 108463423 missense possibly damaging 0.61
R5144:Ccdc71 UTSW 9 108463852 missense probably benign
R6379:Ccdc71 UTSW 9 108463612 missense possibly damaging 0.82
R7406:Ccdc71 UTSW 9 108463324 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAAGTGCTGGTTTGTGGATACCC -3'
(R):5'- ACTGTTGTACCACTGCTGTTGCTG -3'

Sequencing Primer
(F):5'- TTTGTGGATACCCAGGCAAGC -3'
(R):5'- GCTCAGCAGCAGGTTAGTG -3'
Posted On2014-03-14