Incidental Mutation 'R1415:Tmem26'
ID159778
Institutional Source Beutler Lab
Gene Symbol Tmem26
Ensembl Gene ENSMUSG00000060044
Gene Nametransmembrane protein 26
Synonyms
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R1415 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location68723646-68782650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68778661 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 302 (F302S)
Ref Sequence ENSEMBL: ENSMUSP00000079789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080995] [ENSMUST00000218918]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080995
AA Change: F302S

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079789
Gene: ENSMUSG00000060044
AA Change: F302S

DomainStartEndE-ValueType
Pfam:Tmem26 3 304 5.6e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218918
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Ccdc71 T A 9: 108,463,208 Y73* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Dnajb11 T C 16: 22,870,621 V264A probably benign Het
Fam135b T C 15: 71,456,928 E1174G probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Gigyf1 A G 5: 137,519,216 probably null Het
Gm38394 C T 1: 133,657,818 V594M possibly damaging Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr462 A C 11: 87,889,647 V83G possibly damaging Het
Olfr667 A G 7: 104,916,336 I320T probably benign Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Secisbp2l C A 2: 125,740,365 G1057V probably benign Het
Slc30a2 C T 4: 134,349,349 T265M probably damaging Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Tmem26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmem26 APN 10 68775354 missense probably damaging 1.00
IGL00471:Tmem26 APN 10 68778681 missense possibly damaging 0.78
IGL01301:Tmem26 APN 10 68778606 missense probably damaging 1.00
IGL01567:Tmem26 APN 10 68751231 missense probably damaging 1.00
IGL02487:Tmem26 APN 10 68778733 missense probably benign 0.00
IGL02713:Tmem26 APN 10 68751295 missense probably damaging 1.00
IGL02828:Tmem26 APN 10 68775385 critical splice donor site probably null
ANU18:Tmem26 UTSW 10 68778606 missense probably damaging 1.00
P0027:Tmem26 UTSW 10 68778718 missense probably benign 0.00
R1649:Tmem26 UTSW 10 68751273 missense probably damaging 1.00
R3871:Tmem26 UTSW 10 68778732 missense probably benign 0.01
R5072:Tmem26 UTSW 10 68775348 missense probably damaging 1.00
R5239:Tmem26 UTSW 10 68751266 missense probably damaging 0.97
R6053:Tmem26 UTSW 10 68748484 missense probably benign 0.00
R6607:Tmem26 UTSW 10 68778713 missense probably benign 0.00
R6710:Tmem26 UTSW 10 68724054 missense probably damaging 1.00
R7378:Tmem26 UTSW 10 68724092 critical splice donor site probably null
T0722:Tmem26 UTSW 10 68778718 missense probably benign 0.00
X0003:Tmem26 UTSW 10 68778718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGCCAGTACAGTGCGGATCTATG -3'
(R):5'- AAGGAACGAGTTAAGCCTCGCAGC -3'

Sequencing Primer
(F):5'- CTATGGGCCATTGGTCTCAGC -3'
(R):5'- GTAAGACTCCTCGGAGGTGAC -3'
Posted On2014-03-14