Incidental Mutation 'R1415:Olfr462'
ID159779
Institutional Source Beutler Lab
Gene Symbol Olfr462
Ensembl Gene ENSMUSG00000093839
Gene Nameolfactory receptor 462
SynonymsMOR240-3, GA_x6K02T2PAEV-9536824-9535889
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.893) question?
Stock #R1415 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location87884979-87892268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 87889647 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 83 (V83G)
Ref Sequence ENSEMBL: ENSMUSP00000150179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049743] [ENSMUST00000081417] [ENSMUST00000213672] [ENSMUST00000213928] [ENSMUST00000215150] [ENSMUST00000217095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049743
AA Change: V83G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000055334
Gene: ENSMUSG00000093839
AA Change: V83G

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.2e-40 PFAM
Pfam:7tm_1 41 287 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081417
SMART Domains Protein: ENSMUSP00000080146
Gene: ENSMUSG00000093920

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 6.3e-41 PFAM
Pfam:7tm_1 41 287 8.6e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213672
AA Change: V83G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213928
AA Change: V83G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000215150
Predicted Effect probably benign
Transcript: ENSMUST00000217095
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Ccdc71 T A 9: 108,463,208 Y73* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Dnajb11 T C 16: 22,870,621 V264A probably benign Het
Fam135b T C 15: 71,456,928 E1174G probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Gigyf1 A G 5: 137,519,216 probably null Het
Gm38394 C T 1: 133,657,818 V594M possibly damaging Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr667 A G 7: 104,916,336 I320T probably benign Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Secisbp2l C A 2: 125,740,365 G1057V probably benign Het
Slc30a2 C T 4: 134,349,349 T265M probably damaging Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tmem26 T C 10: 68,778,661 F302S possibly damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Olfr462
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0613:Olfr462 UTSW 11 87889227 missense possibly damaging 0.90
R1116:Olfr462 UTSW 11 87889408 missense probably benign 0.00
R1371:Olfr462 UTSW 11 87889296 missense probably damaging 1.00
R1444:Olfr462 UTSW 11 87889759 missense probably benign 0.00
R4591:Olfr462 UTSW 11 87889549 missense probably benign 0.35
R4860:Olfr462 UTSW 11 87889225 missense probably damaging 1.00
R4860:Olfr462 UTSW 11 87889225 missense probably damaging 1.00
R5019:Olfr462 UTSW 11 87888975 missense probably benign
R5521:Olfr462 UTSW 11 87889719 missense probably damaging 0.99
R6967:Olfr462 UTSW 11 87889498 missense probably benign 0.02
R7186:Olfr462 UTSW 11 87889765 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- ATTGGGGCCACAGAATGGCAAC -3'
(R):5'- TTCTTGTGTGTCTACAGCACGACC -3'

Sequencing Primer
(F):5'- CCAGTACTACACAGTGTTGAGTG -3'
(R):5'- CGTGGTGGGAAACCTCCTC -3'
Posted On2014-03-14