Mutagenetix > Incidental Mutation

Incidental Mutation 'R1415:Adam21'

159780

Institutional Source

Beutler Lab

Gene Symbol

Adam21

Ensembl Gene

ENSMUSG00000008438

Gene Name

a disintegrin and metallopeptidase domain 21

Synonyms

ADAM31

MMRRC Submission

039471-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1415 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

81558584-81568474 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 81559547 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 480 (W480*)

Ref Sequence

ENSEMBL: ENSMUSP00000008582 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008582]

AlphaFold

Q9JI76

Predicted Effect

probably null
Transcript: ENSMUST00000008582
AA Change: W480*

SMART Domains

Protein: ENSMUSP00000008582
Gene: ENSMUSG00000008438
AA Change: W480*

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Pfam:Pep_M12B_propep	39	164	5.1e-21	PFAM
Pfam:Reprolysin_4	212	389	2.5e-11	PFAM
Pfam:Reprolysin	212	402	7.3e-50	PFAM
Pfam:Reprolysin_5	214	400	5.8e-19	PFAM
Pfam:Reprolysin_2	233	393	1.3e-14	PFAM
Pfam:Reprolysin_3	236	356	6.5e-16	PFAM
DISIN	419	494	2.45e-37	SMART
ACR	495	631	6.49e-62	SMART
EGF	637	667	2.03e1	SMART
transmembrane domain	687	709	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166971

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. The encoded protein functions in the regulation of spermatogenesis in the testes and neurogenesis in the central nervous system. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	T	C	5: 114,165,921	V135A	probably benign	Het
Ccdc71	T	A	9: 108,463,208	Y73*	probably null	Het
Cfap44	T	A	16: 44,481,389	I1830N	probably damaging	Het
Dnajb11	T	C	16: 22,870,621	V264A	probably benign	Het
Fam135b	T	C	15: 71,456,928	E1174G	probably damaging	Het
Fam83e	G	A	7: 45,726,711	E283K	probably damaging	Het
Gigyf1	A	G	5: 137,519,216		probably null	Het
Gm38394	C	T	1: 133,657,818	V594M	possibly damaging	Het
Letm1	A	T	5: 33,769,562	N130K	probably benign	Het
Lrp1b	T	C	2: 40,629,664	Y137C	probably damaging	Het
Map3k2	A	G	18: 32,228,277	I597V	possibly damaging	Het
Nek1	A	G	8: 61,089,686	E770G	probably benign	Het
Olfr462	A	C	11: 87,889,647	V83G	possibly damaging	Het
Olfr667	A	G	7: 104,916,336	I320T	probably benign	Het
Pank2	T	A	2: 131,282,718	Y68*	probably null	Het
Prl2c2	G	C	13: 13,002,201	T47R	probably damaging	Het
Secisbp2l	C	A	2: 125,740,365	G1057V	probably benign	Het
Slc30a2	C	T	4: 134,349,349	T265M	probably damaging	Het
Smarca2	A	G	19: 26,710,684	E1239G	probably null	Het
Snx30	C	T	4: 59,879,261	R167C	probably damaging	Het
Tmem26	T	C	10: 68,778,661	F302S	possibly damaging	Het
Tpgs2	A	G	18: 25,168,553	L19S	probably damaging	Het
Trp53bp1	T	G	2: 121,236,184	E687A	probably damaging	Het
Ttc27	C	T	17: 74,739,672	H243Y	probably benign	Het
Wdfy4	A	T	14: 33,041,180	V2318D	possibly damaging	Het
Wdr59	G	A	8: 111,498,596	P141S	probably damaging	Het
Zfp787	C	A	7: 6,132,695	G186C	probably damaging	Het

Other mutations in Adam21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02186:Adam21	APN	12	81559209	missense	possibly damaging	0.61
IGL02311:Adam21	APN	12	81560892	missense	probably benign	0.01
IGL03132:Adam21	APN	12	81560374	nonsense	probably null
IGL03225:Adam21	APN	12	81559269	missense	probably benign	0.00
BB009:Adam21	UTSW	12	81560164	missense	probably damaging	0.98
BB019:Adam21	UTSW	12	81560164	missense	probably damaging	0.98
R0305:Adam21	UTSW	12	81560285	missense	possibly damaging	0.96
R0634:Adam21	UTSW	12	81560352	missense	probably benign	0.01
R1961:Adam21	UTSW	12	81559508	nonsense	probably null
R1996:Adam21	UTSW	12	81559602	missense	possibly damaging	0.79
R2159:Adam21	UTSW	12	81560467	missense	probably benign	0.17
R2215:Adam21	UTSW	12	81560290	missense	probably damaging	1.00
R3780:Adam21	UTSW	12	81559273	missense	probably damaging	1.00
R3964:Adam21	UTSW	12	81560809	missense	possibly damaging	0.46
R4356:Adam21	UTSW	12	81558820	missense	probably damaging	0.99
R4503:Adam21	UTSW	12	81560898	missense	probably benign
R4795:Adam21	UTSW	12	81560974	missense	probably benign	0.06
R4925:Adam21	UTSW	12	81560389	missense	probably benign
R4932:Adam21	UTSW	12	81558918	missense	probably benign	0.14
R5110:Adam21	UTSW	12	81560215	missense	probably benign	0.40
R5831:Adam21	UTSW	12	81559101	missense	probably benign	0.06
R6289:Adam21	UTSW	12	81560706	missense	probably damaging	1.00
R6500:Adam21	UTSW	12	81559606	missense	probably benign	0.01
R7077:Adam21	UTSW	12	81559119	missense	probably damaging	1.00
R7083:Adam21	UTSW	12	81560241	missense	possibly damaging	0.81
R7173:Adam21	UTSW	12	81559234	missense	probably benign	0.24
R7176:Adam21	UTSW	12	81560248	missense	possibly damaging	0.94
R7232:Adam21	UTSW	12	81560556	missense	probably damaging	0.99
R7371:Adam21	UTSW	12	81560290	missense	probably damaging	1.00
R7486:Adam21	UTSW	12	81558883	missense	probably benign	0.00
R7522:Adam21	UTSW	12	81558948	missense	possibly damaging	0.78
R7918:Adam21	UTSW	12	81560604	missense	possibly damaging	0.64
R7932:Adam21	UTSW	12	81560164	missense	probably damaging	0.98
R8040:Adam21	UTSW	12	81560437	missense	probably benign	0.04
R8486:Adam21	UTSW	12	81560776	missense	probably benign	0.08
R8750:Adam21	UTSW	12	81560473	nonsense	probably null
R8881:Adam21	UTSW	12	81559876	missense	probably benign	0.02
R9084:Adam21	UTSW	12	81559386	missense	probably damaging	1.00
R9541:Adam21	UTSW	12	81560950	missense	probably benign
R9564:Adam21	UTSW	12	81559059	missense	probably damaging	1.00
Z1088:Adam21	UTSW	12	81560686	missense	probably damaging	1.00
Z1176:Adam21	UTSW	12	81559743	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGTGCCATCTGTGCCACAATG -3'
(R):5'- AGAGTGCCAGCAGAGAGATTCACC -3'

Sequencing Primer
(F):5'- GGCCAAACCTGTTTCCTTG -3'
(R):5'- CCAAGGAACTTGTCTGTACAATC -3'

Posted On

2014-03-14