Incidental Mutation 'R1415:Fam135b'
ID159784
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1415 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71456928 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1174 (E1174G)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953]
Predicted Effect probably damaging
Transcript: ENSMUST00000022953
AA Change: E1174G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: E1174G

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229634
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Ccdc71 T A 9: 108,463,208 Y73* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Dnajb11 T C 16: 22,870,621 V264A probably benign Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Gigyf1 A G 5: 137,519,216 probably null Het
Gm38394 C T 1: 133,657,818 V594M possibly damaging Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr462 A C 11: 87,889,647 V83G possibly damaging Het
Olfr667 A G 7: 104,916,336 I320T probably benign Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Secisbp2l C A 2: 125,740,365 G1057V probably benign Het
Slc30a2 C T 4: 134,349,349 T265M probably damaging Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tmem26 T C 10: 68,778,661 F302S possibly damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2076:Fam135b UTSW 15 71478243 missense probably damaging 0.99
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5044:Fam135b UTSW 15 71462711 missense probably benign 0.02
R5469:Fam135b UTSW 15 71446043 missense probably benign 0.16
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R5987:Fam135b UTSW 15 71490848 missense probably benign 0.00
R6535:Fam135b UTSW 15 71622075 missense probably damaging 0.99
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71622068 missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7545:Fam135b UTSW 15 71450510 missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7686:Fam135b UTSW 15 71463384 missense possibly damaging 0.68
R7866:Fam135b UTSW 15 71462076 missense probably benign 0.00
R7949:Fam135b UTSW 15 71462076 missense probably benign 0.00
R8006:Fam135b UTSW 15 71462334 missense not run
R8068:Fam135b UTSW 15 71532978 missense not run
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71622076 start codon destroyed not run
Predicted Primers PCR Primer
(F):5'- GTGAAGCCAGAGGTTTCCACTCAG -3'
(R):5'- CACTGTGCCATCATTAGGTAGCCC -3'

Sequencing Primer
(F):5'- TAGTTACACATGAACTTCTACCCC -3'
(R):5'- TGCCAGGTCAAGGTATAATTCCAC -3'
Posted On2014-03-14