Incidental Mutation 'R1415:Dnajb11'
ID159785
Institutional Source Beutler Lab
Gene Symbol Dnajb11
Ensembl Gene ENSMUSG00000004460
Gene NameDnaJ heat shock protein family (Hsp40) member B11
SynonymsABBP-2, Dj9, ERdj3, 1810031F23Rik
MMRRC Submission 039471-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R1415 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22857845-22879634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22870621 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 264 (V264A)
Ref Sequence ENSEMBL: ENSMUSP00000137542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004574] [ENSMUST00000133013] [ENSMUST00000166487] [ENSMUST00000178320]
Predicted Effect probably benign
Transcript: ENSMUST00000004574
AA Change: V264A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000004574
Gene: ENSMUSG00000004460
AA Change: V264A

DomainStartEndE-ValueType
DnaJ 24 82 4.04e-32 SMART
low complexity region 102 119 N/A INTRINSIC
Pfam:CTDII 257 338 3.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132105
Predicted Effect probably benign
Transcript: ENSMUST00000133013
AA Change: V33A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000166487
AA Change: V264A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126828
Gene: ENSMUSG00000004460
AA Change: V264A

DomainStartEndE-ValueType
DnaJ 24 82 4.04e-32 SMART
low complexity region 102 119 N/A INTRINSIC
Pfam:CTDII 257 338 3.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178320
AA Change: V264A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137542
Gene: ENSMUSG00000004460
AA Change: V264A

DomainStartEndE-ValueType
DnaJ 24 82 4.04e-32 SMART
low complexity region 102 119 N/A INTRINSIC
Pfam:DnaJ_C 134 327 3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231692
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a soluble glycoprotein of the endoplasmic reticulum (ER) lumen that functions as a co-chaperone of binding immunoglobulin protein, a 70 kilodalton heat shock protein chaperone required for the proper folding and assembly of proteins in the ER. The encoded protein contains a highly conserved J domain of about 70 amino acids with a characteristic His-Pro-Asp (HPD) motif and may regulate the activity of binding immunoglobulin protein by stimulating ATPase activity. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T C 5: 114,165,921 V135A probably benign Het
Adam21 C T 12: 81,559,547 W480* probably null Het
Ccdc71 T A 9: 108,463,208 Y73* probably null Het
Cfap44 T A 16: 44,481,389 I1830N probably damaging Het
Fam135b T C 15: 71,456,928 E1174G probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Gigyf1 A G 5: 137,519,216 probably null Het
Gm38394 C T 1: 133,657,818 V594M possibly damaging Het
Letm1 A T 5: 33,769,562 N130K probably benign Het
Lrp1b T C 2: 40,629,664 Y137C probably damaging Het
Map3k2 A G 18: 32,228,277 I597V possibly damaging Het
Nek1 A G 8: 61,089,686 E770G probably benign Het
Olfr462 A C 11: 87,889,647 V83G possibly damaging Het
Olfr667 A G 7: 104,916,336 I320T probably benign Het
Pank2 T A 2: 131,282,718 Y68* probably null Het
Prl2c2 G C 13: 13,002,201 T47R probably damaging Het
Secisbp2l C A 2: 125,740,365 G1057V probably benign Het
Slc30a2 C T 4: 134,349,349 T265M probably damaging Het
Smarca2 A G 19: 26,710,684 E1239G probably null Het
Snx30 C T 4: 59,879,261 R167C probably damaging Het
Tmem26 T C 10: 68,778,661 F302S possibly damaging Het
Tpgs2 A G 18: 25,168,553 L19S probably damaging Het
Trp53bp1 T G 2: 121,236,184 E687A probably damaging Het
Ttc27 C T 17: 74,739,672 H243Y probably benign Het
Wdfy4 A T 14: 33,041,180 V2318D possibly damaging Het
Wdr59 G A 8: 111,498,596 P141S probably damaging Het
Zfp787 C A 7: 6,132,695 G186C probably damaging Het
Other mutations in Dnajb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01153:Dnajb11 APN 16 22862680 missense probably benign 0.02
IGL01952:Dnajb11 APN 16 22865500 missense probably damaging 1.00
IGL02581:Dnajb11 APN 16 22871018 missense probably benign 0.02
IGL03117:Dnajb11 APN 16 22869138 missense probably benign 0.04
R0054:Dnajb11 UTSW 16 22862619 missense probably damaging 1.00
R0054:Dnajb11 UTSW 16 22862619 missense probably damaging 1.00
R0765:Dnajb11 UTSW 16 22862568 missense probably damaging 1.00
R1174:Dnajb11 UTSW 16 22870673 missense probably damaging 1.00
R1175:Dnajb11 UTSW 16 22870673 missense probably damaging 1.00
R4021:Dnajb11 UTSW 16 22869446 missense probably damaging 1.00
R4022:Dnajb11 UTSW 16 22869446 missense probably damaging 1.00
R6041:Dnajb11 UTSW 16 22868721 missense probably benign 0.00
R6403:Dnajb11 UTSW 16 22870941 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGCTAAGCATGGCCTTTCTTTTC -3'
(R):5'- ATCACACAACTTCTACTGGGCACTG -3'

Sequencing Primer
(F):5'- AAGCATGGCCTTTCTTTTCTATAAC -3'
(R):5'- CTAGTAGTGTCACAGCTCAGCAG -3'
Posted On2014-03-14