Mutagenetix > Incidental Mutation

Incidental Mutation 'R1421:Atg16l1'

159795

Institutional Source

Beutler Lab

Gene Symbol

Atg16l1

Ensembl Gene

ENSMUSG00000026289

Gene Name

autophagy related 16-like 1 (S. cerevisiae)

Synonyms

1500009K01Rik, APG16L, WDR30

MMRRC Submission

039477-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1421 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87755870-87792428 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 87786358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190]

AlphaFold

Q8C0J2

Predicted Effect

probably benign
Transcript: ENSMUST00000027512

SMART Domains

Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	1.3e-63	PFAM
low complexity region	237	246	N/A	INTRINSIC
WD40	311	350	7.05e-9	SMART
WD40	355	394	7.28e-2	SMART
WD40	397	436	1.07e-8	SMART
WD40	439	475	3.7e0	SMART
WD40	478	516	5.35e-1	SMART
WD40	519	562	1.2e-2	SMART
WD40	565	605	6.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113186

SMART Domains

Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289

Domain	Start	End	E-Value	Type
Pfam:ATG16	13	207	3.7e-64	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	257	271	N/A	INTRINSIC
WD40	292	331	7.05e-9	SMART
WD40	336	375	7.28e-2	SMART
WD40	378	417	1.07e-8	SMART
WD40	420	456	3.7e0	SMART
WD40	459	497	5.35e-1	SMART
WD40	500	543	1.2e-2	SMART
WD40	546	586	6.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113190

SMART Domains

Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289

Domain	Start	End	E-Value	Type
Pfam:ATG16	16	206	6.5e-49	PFAM
low complexity region	237	246	N/A	INTRINSIC
low complexity region	295	306	N/A	INTRINSIC
WD40	327	366	7.05e-9	SMART
WD40	371	410	7.28e-2	SMART
WD40	413	452	1.07e-8	SMART
WD40	455	491	3.7e0	SMART
WD40	494	532	5.35e-1	SMART
WD40	535	578	1.2e-2	SMART
WD40	581	621	6.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127884

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158656

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	A	G	10: 116,113,438	V61A	probably damaging	Het
A2ml1	T	C	6: 128,543,960	T1344A	probably benign	Het
Abcf1	G	A	17: 35,960,909	A375V	probably damaging	Het
Adam20	T	A	8: 40,796,747	H631Q	possibly damaging	Het
Adcy10	T	C	1: 165,563,947	S1258P	probably damaging	Het
Agtpbp1	A	G	13: 59,495,575	I717T	possibly damaging	Het
Ahnak	T	A	19: 9,015,631	F4760I	possibly damaging	Het
Ano6	A	G	15: 95,913,385	K122R	probably benign	Het
Arhgap5	T	C	12: 52,516,848	C201R	probably damaging	Het
Cdhr3	A	T	12: 33,060,292	I331K	probably damaging	Het
Coq8a	A	G	1: 180,170,441		probably benign	Het
Crebbp	A	G	16: 4,124,647	V662A	probably damaging	Het
Cspg4	T	A	9: 56,896,626	M1667K	probably benign	Het
Dnah7a	A	G	1: 53,540,873		probably benign	Het
Dnajc6	A	T	4: 101,611,316	Y251F	probably damaging	Het
Dpy19l4	A	T	4: 11,304,011	M133K	probably benign	Het
Emb	T	C	13: 117,272,088	Y322H	probably benign	Het
Fam196a	A	T	7: 134,899,231		probably benign	Het
Gcm1	A	T	9: 78,059,700	H67L	probably damaging	Het
Gls2	A	T	10: 128,201,348	K253*	probably null	Het
Gm28042	T	A	2: 120,036,463	S196T	probably benign	Het
Gm43302	T	C	5: 105,217,349	T598A	probably benign	Het
Gramd1a	T	A	7: 31,142,866	Q90L	probably damaging	Het
Grhl2	A	G	15: 37,309,716	Y352C	probably damaging	Het
Ifi203-ps	T	C	1: 173,797,997		noncoding transcript	Het
Ifitm2	T	C	7: 140,955,059	I121V	probably benign	Het
Kptn	T	G	7: 16,123,024		probably benign	Het
L2hgdh	C	T	12: 69,701,318	D345N	probably benign	Het
Lgals12	T	C	19: 7,606,714	H6R	probably benign	Het
Lrrc4b	A	G	7: 44,461,051	I116V	probably benign	Het
Misp	A	G	10: 79,826,847	D366G	probably damaging	Het
Nav1	T	C	1: 135,585,010	E104G	probably damaging	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Parp1	T	C	1: 180,600,088		probably benign	Het
Pikfyve	G	A	1: 65,271,311	G1919D	probably damaging	Het
Pomt1	A	G	2: 32,236,753		probably benign	Het
Prrc2b	C	T	2: 32,200,978	S454F	possibly damaging	Het
Selenbp1	T	C	3: 94,943,872	S360P	probably benign	Het
Slc6a12	T	A	6: 121,359,126	I352N	probably damaging	Het
Snx9	G	A	17: 5,902,484	G197D	probably benign	Het
Ston1	T	C	17: 88,635,793	V209A	probably benign	Het
Tex36	A	T	7: 133,595,349		probably null	Het
Tnnt3	A	G	7: 142,511,366	E108G	probably damaging	Het
Vmn2r98	T	A	17: 19,065,178	F87I	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wdr64	T	C	1: 175,767,150	I479T	possibly damaging	Het
Xrcc5	A	G	1: 72,310,477	N22D	probably benign	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp735	C	A	11: 73,710,697	L156I	probably benign	Het
Zfp820	A	T	17: 21,819,880	Y156N	possibly damaging	Het

Other mutations in Atg16l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Atg16l1	APN	1	87765397	missense	possibly damaging	0.68
IGL00861:Atg16l1	APN	1	87774838	missense	probably damaging	1.00
IGL01065:Atg16l1	APN	1	87785931	missense	probably damaging	0.99
IGL01068:Atg16l1	APN	1	87774824	missense	probably damaging	1.00
IGL01140:Atg16l1	APN	1	87774853	missense	probably benign	0.03
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0023:Atg16l1	UTSW	1	87789465	missense	probably benign	0.00
R0650:Atg16l1	UTSW	1	87781699	missense	possibly damaging	0.93
R0655:Atg16l1	UTSW	1	87766829	missense	probably damaging	1.00
R1549:Atg16l1	UTSW	1	87774188	missense	probably benign
R2202:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R2204:Atg16l1	UTSW	1	87767015	missense	probably benign	0.03
R3689:Atg16l1	UTSW	1	87785904	missense	probably damaging	1.00
R4012:Atg16l1	UTSW	1	87766907	missense	probably damaging	1.00
R4391:Atg16l1	UTSW	1	87760120	missense	probably damaging	0.97
R4839:Atg16l1	UTSW	1	87766174	missense	probably damaging	0.99
R4935:Atg16l1	UTSW	1	87767042	missense	possibly damaging	0.69
R4980:Atg16l1	UTSW	1	87766831	missense	possibly damaging	0.89
R4990:Atg16l1	UTSW	1	87789369	missense	probably benign	0.00
R5011:Atg16l1	UTSW	1	87774180	nonsense	probably null
R5457:Atg16l1	UTSW	1	87775091	missense	probably damaging	0.96
R5897:Atg16l1	UTSW	1	87785997	critical splice donor site	probably null
R6289:Atg16l1	UTSW	1	87756215	missense	probably damaging	0.99
R6437:Atg16l1	UTSW	1	87790648	missense	probably damaging	1.00
R6727:Atg16l1	UTSW	1	87774854	missense	possibly damaging	0.68
R6923:Atg16l1	UTSW	1	87774356	splice site	probably null
R7423:Atg16l1	UTSW	1	87786301	missense	probably damaging	1.00
R7475:Atg16l1	UTSW	1	87760083	missense	possibly damaging	0.89
R8493:Atg16l1	UTSW	1	87778982	missense	probably damaging	1.00
R8742:Atg16l1	UTSW	1	87766898	missense	probably damaging	1.00
R8782:Atg16l1	UTSW	1	87786288	missense	possibly damaging	0.76
R9035:Atg16l1	UTSW	1	87765445	critical splice donor site	probably null
R9071:Atg16l1	UTSW	1	87756185	intron	probably benign
R9282:Atg16l1	UTSW	1	87780184	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- GATGCTCCACAGCAGTTAGAACCC -3'
(R):5'- ATGACGCTGGACCCAGAAGACTAC -3'

Sequencing Primer
(F):5'- CCTTTCAGTCTGAGGAGCG -3'
(R):5'- AAGCATGCTCGCAGCTCTT -3'

Posted On

2014-03-14