Incidental Mutation 'R1421:Atg16l1'
ID 159795
Institutional Source Beutler Lab
Gene Symbol Atg16l1
Ensembl Gene ENSMUSG00000026289
Gene Name autophagy related 16 like 1
Synonyms WDR30, APG16L, 1500009K01Rik
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1421 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 87683730-87720150 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 87714080 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190]
AlphaFold Q8C0J2
Predicted Effect probably benign
Transcript: ENSMUST00000027512
SMART Domains Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289

DomainStartEndE-ValueType
Pfam:ATG16 13 207 1.3e-63 PFAM
low complexity region 237 246 N/A INTRINSIC
WD40 311 350 7.05e-9 SMART
WD40 355 394 7.28e-2 SMART
WD40 397 436 1.07e-8 SMART
WD40 439 475 3.7e0 SMART
WD40 478 516 5.35e-1 SMART
WD40 519 562 1.2e-2 SMART
WD40 565 605 6.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113186
SMART Domains Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289

DomainStartEndE-ValueType
Pfam:ATG16 13 207 3.7e-64 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
WD40 292 331 7.05e-9 SMART
WD40 336 375 7.28e-2 SMART
WD40 378 417 1.07e-8 SMART
WD40 420 456 3.7e0 SMART
WD40 459 497 5.35e-1 SMART
WD40 500 543 1.2e-2 SMART
WD40 546 586 6.89e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113190
SMART Domains Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289

DomainStartEndE-ValueType
Pfam:ATG16 16 206 6.5e-49 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
WD40 327 366 7.05e-9 SMART
WD40 371 410 7.28e-2 SMART
WD40 413 452 1.07e-8 SMART
WD40 455 491 3.7e0 SMART
WD40 494 532 5.35e-1 SMART
WD40 535 578 1.2e-2 SMART
WD40 581 621 6.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158656
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Agtpbp1 A G 13: 59,643,389 (GRCm39) I717T possibly damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dnajc6 A T 4: 101,468,513 (GRCm39) Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Gm43302 T C 5: 105,365,215 (GRCm39) T598A probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Grhl2 A G 15: 37,309,960 (GRCm39) Y352C probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Ifitm2 T C 7: 140,534,972 (GRCm39) I121V probably benign Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lgals12 T C 19: 7,584,079 (GRCm39) H6R probably benign Het
Lrrc4b A G 7: 44,110,475 (GRCm39) I116V probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Slc6a12 T A 6: 121,336,085 (GRCm39) I352N probably damaging Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Ston1 T C 17: 88,943,221 (GRCm39) V209A probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Atg16l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Atg16l1 APN 1 87,693,119 (GRCm39) missense possibly damaging 0.68
IGL00861:Atg16l1 APN 1 87,702,560 (GRCm39) missense probably damaging 1.00
IGL01065:Atg16l1 APN 1 87,713,653 (GRCm39) missense probably damaging 0.99
IGL01068:Atg16l1 APN 1 87,702,546 (GRCm39) missense probably damaging 1.00
IGL01140:Atg16l1 APN 1 87,702,575 (GRCm39) missense probably benign 0.03
R0023:Atg16l1 UTSW 1 87,717,187 (GRCm39) missense probably benign 0.00
R0023:Atg16l1 UTSW 1 87,717,187 (GRCm39) missense probably benign 0.00
R0650:Atg16l1 UTSW 1 87,709,421 (GRCm39) missense possibly damaging 0.93
R0655:Atg16l1 UTSW 1 87,694,551 (GRCm39) missense probably damaging 1.00
R1549:Atg16l1 UTSW 1 87,701,910 (GRCm39) missense probably benign
R2202:Atg16l1 UTSW 1 87,694,737 (GRCm39) missense probably benign 0.03
R2204:Atg16l1 UTSW 1 87,694,737 (GRCm39) missense probably benign 0.03
R3689:Atg16l1 UTSW 1 87,713,626 (GRCm39) missense probably damaging 1.00
R4012:Atg16l1 UTSW 1 87,694,629 (GRCm39) missense probably damaging 1.00
R4391:Atg16l1 UTSW 1 87,687,842 (GRCm39) missense probably damaging 0.97
R4839:Atg16l1 UTSW 1 87,693,896 (GRCm39) missense probably damaging 0.99
R4935:Atg16l1 UTSW 1 87,694,764 (GRCm39) missense possibly damaging 0.69
R4980:Atg16l1 UTSW 1 87,694,553 (GRCm39) missense possibly damaging 0.89
R4990:Atg16l1 UTSW 1 87,717,091 (GRCm39) missense probably benign 0.00
R5011:Atg16l1 UTSW 1 87,701,902 (GRCm39) nonsense probably null
R5457:Atg16l1 UTSW 1 87,702,813 (GRCm39) missense probably damaging 0.96
R5897:Atg16l1 UTSW 1 87,713,719 (GRCm39) critical splice donor site probably null
R6289:Atg16l1 UTSW 1 87,683,937 (GRCm39) missense probably damaging 0.99
R6437:Atg16l1 UTSW 1 87,718,370 (GRCm39) missense probably damaging 1.00
R6727:Atg16l1 UTSW 1 87,702,576 (GRCm39) missense possibly damaging 0.68
R6923:Atg16l1 UTSW 1 87,702,078 (GRCm39) splice site probably null
R7423:Atg16l1 UTSW 1 87,714,023 (GRCm39) missense probably damaging 1.00
R7475:Atg16l1 UTSW 1 87,687,805 (GRCm39) missense possibly damaging 0.89
R8493:Atg16l1 UTSW 1 87,706,704 (GRCm39) missense probably damaging 1.00
R8742:Atg16l1 UTSW 1 87,694,620 (GRCm39) missense probably damaging 1.00
R8782:Atg16l1 UTSW 1 87,714,010 (GRCm39) missense possibly damaging 0.76
R9035:Atg16l1 UTSW 1 87,693,167 (GRCm39) critical splice donor site probably null
R9071:Atg16l1 UTSW 1 87,683,907 (GRCm39) intron probably benign
R9282:Atg16l1 UTSW 1 87,707,906 (GRCm39) missense possibly damaging 0.70
R9706:Atg16l1 UTSW 1 87,713,977 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GATGCTCCACAGCAGTTAGAACCC -3'
(R):5'- ATGACGCTGGACCCAGAAGACTAC -3'

Sequencing Primer
(F):5'- CCTTTCAGTCTGAGGAGCG -3'
(R):5'- AAGCATGCTCGCAGCTCTT -3'
Posted On 2014-03-14