Mutagenetix > Incidental Mutation

Incidental Mutation 'R1421:Nav1'

159796

Institutional Source

Beutler Lab

Gene Symbol

Nav1

Ensembl Gene

ENSMUSG00000009418

Gene Name

neuron navigator 1

Synonyms

steerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3

MMRRC Submission

039477-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.940) question?

Stock #

R1421 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135434580-135607295 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135585010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 104 (E104G)

Ref Sequence

ENSEMBL: ENSMUSP00000140322 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]

AlphaFold

Q8CH77

Predicted Effect

probably damaging
Transcript: ENSMUST00000040599
AA Change: E104G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: E104G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1070	1105	N/A	INTRINSIC
low complexity region	1179	1210	N/A	INTRINSIC
low complexity region	1260	1281	N/A	INTRINSIC
low complexity region	1296	1304	N/A	INTRINSIC
coiled coil region	1328	1360	N/A	INTRINSIC
AAA	1548	1702	3.16e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000067414
AA Change: E104G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: E104G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1070	1105	N/A	INTRINSIC
low complexity region	1179	1210	N/A	INTRINSIC
low complexity region	1260	1281	N/A	INTRINSIC
low complexity region	1296	1304	N/A	INTRINSIC
coiled coil region	1328	1360	N/A	INTRINSIC
AAA	1548	1702	3.16e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000067468

SMART Domains

Protein: ENSMUSP00000067952
Gene: ENSMUSG00000054412

Domain	Start	End	E-Value	Type
low complexity region	118	146	N/A	INTRINSIC
transmembrane domain	164	181	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000190298
AA Change: E104G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418
AA Change: E104G

Domain	Start	End	E-Value	Type
low complexity region	16	33	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	303	318	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
low complexity region	436	456	N/A	INTRINSIC
low complexity region	739	749	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	892	913	N/A	INTRINSIC
low complexity region	975	989	N/A	INTRINSIC
coiled coil region	1013	1048	N/A	INTRINSIC
low complexity region	1122	1153	N/A	INTRINSIC
low complexity region	1200	1221	N/A	INTRINSIC
low complexity region	1236	1244	N/A	INTRINSIC
coiled coil region	1268	1300	N/A	INTRINSIC
AAA	1488	1642	3.16e-5	SMART

Meta Mutation Damage Score

0.1141

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	A	G	10: 116,113,438	V61A	probably damaging	Het
A2ml1	T	C	6: 128,543,960	T1344A	probably benign	Het
Abcf1	G	A	17: 35,960,909	A375V	probably damaging	Het
Adam20	T	A	8: 40,796,747	H631Q	possibly damaging	Het
Adcy10	T	C	1: 165,563,947	S1258P	probably damaging	Het
Agtpbp1	A	G	13: 59,495,575	I717T	possibly damaging	Het
Ahnak	T	A	19: 9,015,631	F4760I	possibly damaging	Het
Ano6	A	G	15: 95,913,385	K122R	probably benign	Het
Arhgap5	T	C	12: 52,516,848	C201R	probably damaging	Het
Atg16l1	T	C	1: 87,786,358		probably benign	Het
Cdhr3	A	T	12: 33,060,292	I331K	probably damaging	Het
Coq8a	A	G	1: 180,170,441		probably benign	Het
Crebbp	A	G	16: 4,124,647	V662A	probably damaging	Het
Cspg4	T	A	9: 56,896,626	M1667K	probably benign	Het
Dnah7a	A	G	1: 53,540,873		probably benign	Het
Dnajc6	A	T	4: 101,611,316	Y251F	probably damaging	Het
Dpy19l4	A	T	4: 11,304,011	M133K	probably benign	Het
Emb	T	C	13: 117,272,088	Y322H	probably benign	Het
Fam196a	A	T	7: 134,899,231		probably benign	Het
Gcm1	A	T	9: 78,059,700	H67L	probably damaging	Het
Gls2	A	T	10: 128,201,348	K253*	probably null	Het
Gm28042	T	A	2: 120,036,463	S196T	probably benign	Het
Gm43302	T	C	5: 105,217,349	T598A	probably benign	Het
Gramd1a	T	A	7: 31,142,866	Q90L	probably damaging	Het
Grhl2	A	G	15: 37,309,716	Y352C	probably damaging	Het
Ifi203-ps	T	C	1: 173,797,997		noncoding transcript	Het
Ifitm2	T	C	7: 140,955,059	I121V	probably benign	Het
Kptn	T	G	7: 16,123,024		probably benign	Het
L2hgdh	C	T	12: 69,701,318	D345N	probably benign	Het
Lgals12	T	C	19: 7,606,714	H6R	probably benign	Het
Lrrc4b	A	G	7: 44,461,051	I116V	probably benign	Het
Misp	A	G	10: 79,826,847	D366G	probably damaging	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Parp1	T	C	1: 180,600,088		probably benign	Het
Pikfyve	G	A	1: 65,271,311	G1919D	probably damaging	Het
Pomt1	A	G	2: 32,236,753		probably benign	Het
Prrc2b	C	T	2: 32,200,978	S454F	possibly damaging	Het
Selenbp1	T	C	3: 94,943,872	S360P	probably benign	Het
Slc6a12	T	A	6: 121,359,126	I352N	probably damaging	Het
Snx9	G	A	17: 5,902,484	G197D	probably benign	Het
Ston1	T	C	17: 88,635,793	V209A	probably benign	Het
Tex36	A	T	7: 133,595,349		probably null	Het
Tnnt3	A	G	7: 142,511,366	E108G	probably damaging	Het
Vmn2r98	T	A	17: 19,065,178	F87I	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wdr64	T	C	1: 175,767,150	I479T	possibly damaging	Het
Xrcc5	A	G	1: 72,310,477	N22D	probably benign	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp735	C	A	11: 73,710,697	L156I	probably benign	Het
Zfp820	A	T	17: 21,819,880	Y156N	possibly damaging	Het

Other mutations in Nav1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01061:Nav1	APN	1	135450630	missense	probably damaging	1.00
IGL01455:Nav1	APN	1	135469635	missense	probably benign	0.44
IGL01650:Nav1	APN	1	135454760	missense	probably damaging	1.00
IGL01872:Nav1	APN	1	135454076	missense	probably damaging	1.00
IGL01967:Nav1	APN	1	135537245	missense	probably damaging	1.00
IGL02167:Nav1	APN	1	135470961	missense	probably damaging	1.00
IGL02278:Nav1	APN	1	135463714	splice site	probably benign
IGL02343:Nav1	APN	1	135454752	nonsense	probably null
IGL02378:Nav1	APN	1	135469978	missense	probably benign	0.02
IGL02554:Nav1	APN	1	135584913	synonymous	silent
IGL03148:Nav1	APN	1	135470024	missense	possibly damaging	0.94
IGL03286:Nav1	APN	1	135454536	missense	probably benign
IGL03372:Nav1	APN	1	135450903	missense	probably damaging	0.99
PIT4802001:Nav1	UTSW	1	135452933	missense	unknown
R0388:Nav1	UTSW	1	135448917	splice site	probably benign
R0390:Nav1	UTSW	1	135449966	missense	possibly damaging	0.80
R0395:Nav1	UTSW	1	135532621	nonsense	probably null
R0395:Nav1	UTSW	1	135532623	missense	probably damaging	0.97
R0416:Nav1	UTSW	1	135471126	missense	possibly damaging	0.73
R0463:Nav1	UTSW	1	135452207	missense	possibly damaging	0.76
R0538:Nav1	UTSW	1	135464692	splice site	probably benign
R0594:Nav1	UTSW	1	135467643	missense	possibly damaging	0.74
R0696:Nav1	UTSW	1	135532614	missense	probably damaging	0.99
R0699:Nav1	UTSW	1	135452949	missense	probably benign	0.00
R0759:Nav1	UTSW	1	135455260	missense	possibly damaging	0.73
R1164:Nav1	UTSW	1	135472410	missense	probably benign
R1169:Nav1	UTSW	1	135455205	missense	probably damaging	1.00
R1401:Nav1	UTSW	1	135460425	missense	probably benign	0.20
R1642:Nav1	UTSW	1	135452272	missense	probably damaging	1.00
R1705:Nav1	UTSW	1	135584599	missense	probably damaging	1.00
R1713:Nav1	UTSW	1	135595234	intron	probably benign
R1728:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1729:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1730:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1739:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1740:Nav1	UTSW	1	135458389	critical splice donor site	probably null
R1762:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1783:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1784:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1785:Nav1	UTSW	1	135584727	missense	possibly damaging	0.82
R1895:Nav1	UTSW	1	135458658	missense	probably damaging	1.00
R1896:Nav1	UTSW	1	135460737	missense	probably benign	0.00
R1901:Nav1	UTSW	1	135472410	missense	probably benign	0.03
R1902:Nav1	UTSW	1	135472410	missense	probably benign	0.03
R1925:Nav1	UTSW	1	135607229	utr 5 prime	probably benign
R1939:Nav1	UTSW	1	135465898	missense	probably damaging	1.00
R1971:Nav1	UTSW	1	135532353	missense	probably benign	0.06
R2063:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2066:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2084:Nav1	UTSW	1	135607420	unclassified	probably benign
R2090:Nav1	UTSW	1	135607165	utr 5 prime	probably benign
R2107:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2110:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2111:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2112:Nav1	UTSW	1	135449004	missense	probably damaging	1.00
R2136:Nav1	UTSW	1	135454436	missense	probably null	0.18
R2268:Nav1	UTSW	1	135472236	nonsense	probably null
R2269:Nav1	UTSW	1	135472236	nonsense	probably null
R2847:Nav1	UTSW	1	135450644	splice site	probably null
R2869:Nav1	UTSW	1	135460757	synonymous	silent
R2871:Nav1	UTSW	1	135460757	synonymous	silent
R2872:Nav1	UTSW	1	135460757	synonymous	silent
R2904:Nav1	UTSW	1	135585238	missense	probably benign
R3690:Nav1	UTSW	1	135467644	missense	probably benign	0.11
R3716:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3717:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3718:Nav1	UTSW	1	135450630	missense	probably damaging	1.00
R3815:Nav1	UTSW	1	135471124	missense	possibly damaging	0.95
R4282:Nav1	UTSW	1	135457913	intron	probably benign
R4361:Nav1	UTSW	1	135607437	unclassified	probably benign
R4610:Nav1	UTSW	1	135592448	intron	probably benign
R4730:Nav1	UTSW	1	135607311	unclassified	probably benign
R4784:Nav1	UTSW	1	135458739	missense	probably damaging	1.00
R4788:Nav1	UTSW	1	135469723	missense	probably benign
R4808:Nav1	UTSW	1	135455204	missense	probably damaging	1.00
R4996:Nav1	UTSW	1	135465971	missense	probably damaging	1.00
R5284:Nav1	UTSW	1	135449963	nonsense	probably null
R5514:Nav1	UTSW	1	135470561	missense	probably benign	0.04
R5769:Nav1	UTSW	1	135452257	missense	probably damaging	1.00
R5834:Nav1	UTSW	1	135532406	missense	probably benign	0.07
R5898:Nav1	UTSW	1	135585146	missense	probably benign
R6081:Nav1	UTSW	1	135470822	missense	probably damaging	1.00
R6344:Nav1	UTSW	1	135450796	missense	probably damaging	1.00
R6378:Nav1	UTSW	1	135454695	missense	probably damaging	1.00
R7001:Nav1	UTSW	1	135454611	splice site	probably null
R7185:Nav1	UTSW	1	135471008	missense	possibly damaging	0.85
R7291:Nav1	UTSW	1	135465859	missense	probably damaging	1.00
R7361:Nav1	UTSW	1	135452853	missense	unknown
R7390:Nav1	UTSW	1	135584918	missense	probably benign	0.01
R7464:Nav1	UTSW	1	135584909	missense	probably benign	0.03
R7502:Nav1	UTSW	1	135469666	missense	probably damaging	1.00
R7601:Nav1	UTSW	1	135460438	missense	unknown
R7625:Nav1	UTSW	1	135467745	missense	probably damaging	1.00
R7639:Nav1	UTSW	1	135471122	missense	probably benign	0.09
R7786:Nav1	UTSW	1	135469995	missense	probably damaging	1.00
R7808:Nav1	UTSW	1	135452248	missense	unknown
R7815:Nav1	UTSW	1	135584639	missense	possibly damaging	0.49
R7825:Nav1	UTSW	1	135450044	missense	probably damaging	0.98
R8030:Nav1	UTSW	1	135537239	missense	probably damaging	1.00
R8370:Nav1	UTSW	1	135471144	nonsense	probably null
R8405:Nav1	UTSW	1	135454770	missense	unknown
R8720:Nav1	UTSW	1	135460726	missense	unknown
R8868:Nav1	UTSW	1	135585205	missense	probably benign	0.05
R8973:Nav1	UTSW	1	135584725	missense	probably benign	0.01
R9039:Nav1	UTSW	1	135443749	missense	unknown
R9261:Nav1	UTSW	1	135460357	missense	unknown
R9523:Nav1	UTSW	1	135452191	missense	unknown
Z1088:Nav1	UTSW	1	135470724	missense	probably benign	0.01
Z1176:Nav1	UTSW	1	135452886	missense	unknown
Z1176:Nav1	UTSW	1	135472420	missense	probably damaging	1.00
Z1177:Nav1	UTSW	1	135469731	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- GCAGTTCGTCATCCGATTTGCCATC -3'
(R):5'- AATGCTGGGCAGCAGCGTCAAG -3'

Sequencing Primer
(F):5'- CCTTGCTGAGAGGCTTGAC -3'
(R):5'- CGAGGTGGAGCTGAgcg -3'

Posted On

2014-03-14