Incidental Mutation 'R1421:Coq8a'
ID159800
Institutional Source Beutler Lab
Gene Symbol Coq8a
Ensembl Gene ENSMUSG00000026489
Gene Namecoenzyme Q8A
Synonyms4632432J16Rik, Cabc1, Adck3
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180165238-180199602 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 180170441 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027766] [ENSMUST00000111117] [ENSMUST00000160169] [ENSMUST00000160879] [ENSMUST00000161300] [ENSMUST00000161632] [ENSMUST00000162769] [ENSMUST00000170472]
Predicted Effect probably benign
Transcript: ENSMUST00000027766
SMART Domains Protein: ENSMUSP00000027766
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111117
SMART Domains Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
low complexity region 484 499 N/A INTRINSIC
Pfam:KELK 529 608 1.1e-32 PFAM
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.6e-29 PFAM
C1 1013 1062 4.09e-7 SMART
PH 1083 1203 6.02e-8 SMART
CNH 1228 1505 3.37e-17 SMART
low complexity region 1550 1562 N/A INTRINSIC
PBD 1571 1606 2.05e-10 SMART
low complexity region 1625 1640 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
low complexity region 1700 1714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143176
SMART Domains Protein: ENSMUSP00000115261
Gene: ENSMUSG00000026490

DomainStartEndE-ValueType
Pfam:DMPK_coil 84 144 1.3e-29 PFAM
C1 203 252 4.09e-7 SMART
PH 273 393 6.02e-8 SMART
CNH 418 695 3.37e-17 SMART
low complexity region 740 752 N/A INTRINSIC
PBD 761 796 1.02e-5 SMART
PBD 802 839 2.21e-1 SMART
low complexity region 877 892 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 952 966 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159591
Predicted Effect probably benign
Transcript: ENSMUST00000160169
SMART Domains Protein: ENSMUSP00000125089
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160879
SMART Domains Protein: ENSMUSP00000141948
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161300
SMART Domains Protein: ENSMUSP00000125002
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:ABC1 93 187 5.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161632
SMART Domains Protein: ENSMUSP00000124481
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 44 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162769
Predicted Effect probably benign
Transcript: ENSMUST00000170472
SMART Domains Protein: ENSMUSP00000128290
Gene: ENSMUSG00000026489

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:ABC1 315 431 5.1e-35 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein similar to yeast ABC1, which functions in an electron-transferring membrane protein complex in the respiratory chain. It is not related to the family of ABC transporter proteins. Expression of this gene is induced by the tumor suppressor p53 and in response to DNA damage, and inhibiting its expression partially suppresses p53-induced apoptosis. Alternatively spliced transcript variants have been found; however, their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Coq8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Coq8a APN 1 180168389 missense probably benign 0.11
IGL01797:Coq8a APN 1 180169719 splice site probably null
IGL01873:Coq8a APN 1 180178977 missense probably damaging 1.00
R1148:Coq8a UTSW 1 180169403 splice site probably benign
R1743:Coq8a UTSW 1 180182229 missense probably benign 0.14
R4678:Coq8a UTSW 1 180170081 missense probably damaging 0.99
R4827:Coq8a UTSW 1 180167338 missense possibly damaging 0.46
R4904:Coq8a UTSW 1 180178603 missense probably damaging 1.00
R5716:Coq8a UTSW 1 180179260 missense possibly damaging 0.94
R5769:Coq8a UTSW 1 180179116 missense probably damaging 1.00
R6636:Coq8a UTSW 1 180178987 missense probably benign 0.00
R6991:Coq8a UTSW 1 180179068 missense probably benign 0.00
R7125:Coq8a UTSW 1 180168801 missense probably damaging 1.00
R7158:Coq8a UTSW 1 180179184 missense probably benign 0.00
R7161:Coq8a UTSW 1 180170341 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTACCCTGATATGCACCCAGCTTG -3'
(R):5'- TGTGTTCATGATGGCCCATGCAG -3'

Sequencing Primer
(F):5'- AGCTTGCCCCACAGCTTG -3'
(R):5'- CATGCAGTGCCACATTAGG -3'
Posted On2014-03-14