Incidental Mutation 'R1421:Gm28042'
ID 159804
Institutional Source Beutler Lab
Gene Symbol Gm28042
Ensembl Gene ENSMUSG00000033852
Gene Name predicted gene, 28042
Synonyms
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.531) question?
Stock # R1421 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 119857974-119873514 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119866944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 196 (S196T)
Ref Sequence ENSEMBL: ENSMUSP00000118458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044675] [ENSMUST00000126150] [ENSMUST00000129685] [ENSMUST00000156805] [ENSMUST00000162393]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000044675
SMART Domains Protein: ENSMUSP00000041220
Gene: ENSMUSG00000098789

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 307 4.31e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125805
SMART Domains Protein: ENSMUSP00000122869
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
Pfam:Cupin_8 2 62 2.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126150
AA Change: S196T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118458
Gene: ENSMUSG00000098488
AA Change: S196T

DomainStartEndE-ValueType
C2 19 119 1.79e-17 SMART
PLAc 233 789 1.99e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129685
AA Change: S419T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115498
Gene: ENSMUSG00000033852
AA Change: S419T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 1012 1.99e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134380
Predicted Effect probably benign
Transcript: ENSMUST00000156805
AA Change: S419T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117535
Gene: ENSMUSG00000033852
AA Change: S419T

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 892 8.56e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136042
Predicted Effect probably benign
Transcript: ENSMUST00000162393
SMART Domains Protein: ENSMUSP00000125329
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 242 4.42e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: This locus represents naturally-occurring readthrough transcription between the neighboring Jmjd7 (jumonji domain containing 7) and Pla2g4b (phospholipase A2, group IVB (cytosolic)) genes on chromosome 2. The readthrough transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Agtpbp1 A G 13: 59,643,389 (GRCm39) I717T possibly damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Atg16l1 T C 1: 87,714,080 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dnajc6 A T 4: 101,468,513 (GRCm39) Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm43302 T C 5: 105,365,215 (GRCm39) T598A probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Grhl2 A G 15: 37,309,960 (GRCm39) Y352C probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Ifitm2 T C 7: 140,534,972 (GRCm39) I121V probably benign Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lgals12 T C 19: 7,584,079 (GRCm39) H6R probably benign Het
Lrrc4b A G 7: 44,110,475 (GRCm39) I116V probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Slc6a12 T A 6: 121,336,085 (GRCm39) I352N probably damaging Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Ston1 T C 17: 88,943,221 (GRCm39) V209A probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Gm28042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Gm28042 APN 2 119,860,837 (GRCm39) missense probably damaging 1.00
IGL01148:Gm28042 APN 2 119,869,519 (GRCm39) missense possibly damaging 0.74
IGL02005:Gm28042 APN 2 119,865,115 (GRCm39) missense possibly damaging 0.95
IGL02237:Gm28042 APN 2 119,870,380 (GRCm39) missense possibly damaging 0.61
IGL02539:Gm28042 APN 2 119,865,702 (GRCm39) missense probably damaging 1.00
IGL02747:Gm28042 APN 2 119,861,875 (GRCm39) missense probably damaging 1.00
IGL02825:Gm28042 APN 2 119,862,125 (GRCm39) missense probably damaging 0.99
IGL02998:Gm28042 APN 2 119,870,635 (GRCm39) missense possibly damaging 0.70
IGL03057:Gm28042 APN 2 119,862,637 (GRCm39) missense probably damaging 1.00
IGL03084:Gm28042 APN 2 119,870,986 (GRCm39) missense probably benign 0.08
IGL03160:Gm28042 APN 2 119,866,309 (GRCm39) missense possibly damaging 0.94
PIT4520001:Gm28042 UTSW 2 119,870,148 (GRCm39) nonsense probably null
R0147:Gm28042 UTSW 2 119,866,944 (GRCm39) missense probably benign 0.00
R0270:Gm28042 UTSW 2 119,872,073 (GRCm39) missense probably benign 0.06
R0315:Gm28042 UTSW 2 119,869,538 (GRCm39) missense probably damaging 1.00
R1589:Gm28042 UTSW 2 119,871,887 (GRCm39) missense probably benign 0.05
R1599:Gm28042 UTSW 2 119,866,944 (GRCm39) missense probably benign 0.00
R1656:Gm28042 UTSW 2 119,869,370 (GRCm39) missense probably damaging 1.00
R1718:Gm28042 UTSW 2 119,866,872 (GRCm39) missense possibly damaging 0.78
R1969:Gm28042 UTSW 2 119,872,096 (GRCm39) makesense probably null
R2164:Gm28042 UTSW 2 119,867,229 (GRCm39) missense probably benign 0.01
R2275:Gm28042 UTSW 2 119,867,310 (GRCm39) missense probably damaging 1.00
R3976:Gm28042 UTSW 2 119,867,237 (GRCm39) missense probably benign 0.11
R4483:Gm28042 UTSW 2 119,866,321 (GRCm39) missense possibly damaging 0.68
R4614:Gm28042 UTSW 2 119,871,639 (GRCm39) missense probably damaging 0.99
R4802:Gm28042 UTSW 2 119,872,535 (GRCm39) utr 3 prime probably benign
R4976:Gm28042 UTSW 2 119,865,124 (GRCm39) missense probably damaging 1.00
R5119:Gm28042 UTSW 2 119,865,124 (GRCm39) missense probably damaging 1.00
R5177:Gm28042 UTSW 2 119,872,082 (GRCm39) splice site probably null
R5340:Gm28042 UTSW 2 119,871,929 (GRCm39) missense probably benign
R5861:Gm28042 UTSW 2 119,865,116 (GRCm39) missense probably damaging 1.00
R6641:Gm28042 UTSW 2 119,870,164 (GRCm39) missense probably damaging 1.00
R7187:Gm28042 UTSW 2 119,870,176 (GRCm39) missense probably damaging 1.00
R7488:Gm28042 UTSW 2 119,870,438 (GRCm39) missense probably benign 0.00
R7699:Gm28042 UTSW 2 119,870,197 (GRCm39) missense possibly damaging 0.81
R7700:Gm28042 UTSW 2 119,870,197 (GRCm39) missense possibly damaging 0.81
R8432:Gm28042 UTSW 2 119,869,077 (GRCm39) missense probably damaging 1.00
R9120:Gm28042 UTSW 2 119,869,462 (GRCm39) missense probably damaging 0.96
R9265:Gm28042 UTSW 2 119,871,705 (GRCm39) missense probably damaging 1.00
R9803:Gm28042 UTSW 2 119,868,984 (GRCm39) missense possibly damaging 0.88
X0019:Gm28042 UTSW 2 119,870,139 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCATGTCAGAGACGATTTCCC -3'
(R):5'- GAGAAAGGACCCTGCGAGTCATTAC -3'

Sequencing Primer
(F):5'- GTCAGAGCGCAAAGTTCAAC -3'
(R):5'- TAACTCCCTGTGGCAAGGAC -3'
Posted On 2014-03-14