Incidental Mutation 'R1421:Dnajc6'
ID 159807
Institutional Source Beutler Lab
Gene Symbol Dnajc6
Ensembl Gene ENSMUSG00000028528
Gene Name DnaJ heat shock protein family (Hsp40) member C6
Synonyms auxilin, 2810027M23Rik
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R1421 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 101353828-101499996 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 101468513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 251 (Y251F)
Ref Sequence ENSEMBL: ENSMUSP00000102546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933] [ENSMUST00000149047] [ENSMUST00000154120]
AlphaFold Q80TZ3
Predicted Effect possibly damaging
Transcript: ENSMUST00000038207
AA Change: Y221F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: Y221F

DomainStartEndE-ValueType
SCOP:d1d5ra2 88 244 1e-20 SMART
PTEN_C2 251 390 5.95e-42 SMART
low complexity region 502 521 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
DnaJ 873 934 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094953
AA Change: Y183F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: Y183F

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106929
AA Change: Y183F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: Y183F

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106930
AA Change: Y183F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: Y183F

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106933
AA Change: Y251F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: Y251F

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
SCOP:d1d5ra2 118 274 1e-20 SMART
PTEN_C2 281 420 5.95e-42 SMART
low complexity region 532 551 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
low complexity region 709 724 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
DnaJ 903 964 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149047
AA Change: Y183F

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000119542
Gene: ENSMUSG00000028528
AA Change: Y183F

DomainStartEndE-ValueType
PDB:3N0A|A 30 194 1e-118 PDB
SCOP:d1d5ra2 50 187 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154120
SMART Domains Protein: ENSMUSP00000114840
Gene: ENSMUSG00000028528

DomainStartEndE-ValueType
PDB:3N0A|A 30 116 4e-54 PDB
SCOP:d1d5ra2 50 101 1e-4 SMART
Meta Mutation Damage Score 0.0775 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Agtpbp1 A G 13: 59,643,389 (GRCm39) I717T possibly damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Atg16l1 T C 1: 87,714,080 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Gm43302 T C 5: 105,365,215 (GRCm39) T598A probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Grhl2 A G 15: 37,309,960 (GRCm39) Y352C probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Ifitm2 T C 7: 140,534,972 (GRCm39) I121V probably benign Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lgals12 T C 19: 7,584,079 (GRCm39) H6R probably benign Het
Lrrc4b A G 7: 44,110,475 (GRCm39) I116V probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Slc6a12 T A 6: 121,336,085 (GRCm39) I352N probably damaging Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Ston1 T C 17: 88,943,221 (GRCm39) V209A probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Dnajc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dnajc6 APN 4 101,365,286 (GRCm39) intron probably benign
IGL02336:Dnajc6 APN 4 101,471,483 (GRCm39) splice site probably null
IGL02551:Dnajc6 APN 4 101,496,550 (GRCm39) missense probably damaging 1.00
IGL02801:Dnajc6 APN 4 101,455,010 (GRCm39) missense probably benign 0.33
IGL02887:Dnajc6 APN 4 101,496,497 (GRCm39) missense probably damaging 1.00
IGL03107:Dnajc6 APN 4 101,474,057 (GRCm39) missense probably damaging 1.00
IGL03271:Dnajc6 APN 4 101,365,274 (GRCm39) intron probably benign
R0091:Dnajc6 UTSW 4 101,473,974 (GRCm39) splice site probably benign
R0384:Dnajc6 UTSW 4 101,456,153 (GRCm39) missense probably damaging 1.00
R0546:Dnajc6 UTSW 4 101,492,388 (GRCm39) missense probably damaging 0.99
R0689:Dnajc6 UTSW 4 101,468,450 (GRCm39) missense possibly damaging 0.91
R1239:Dnajc6 UTSW 4 101,492,313 (GRCm39) missense probably damaging 0.98
R1424:Dnajc6 UTSW 4 101,496,544 (GRCm39) missense possibly damaging 0.92
R1563:Dnajc6 UTSW 4 101,456,334 (GRCm39) missense probably damaging 1.00
R1608:Dnajc6 UTSW 4 101,456,364 (GRCm39) missense probably damaging 1.00
R1757:Dnajc6 UTSW 4 101,455,028 (GRCm39) missense probably damaging 1.00
R1856:Dnajc6 UTSW 4 101,456,185 (GRCm39) missense probably damaging 1.00
R2032:Dnajc6 UTSW 4 101,471,435 (GRCm39) missense probably benign 0.39
R2518:Dnajc6 UTSW 4 101,470,127 (GRCm39) missense probably damaging 0.99
R4028:Dnajc6 UTSW 4 101,474,054 (GRCm39) missense probably damaging 1.00
R4088:Dnajc6 UTSW 4 101,496,593 (GRCm39) missense probably damaging 1.00
R4601:Dnajc6 UTSW 4 101,468,461 (GRCm39) missense probably damaging 1.00
R4602:Dnajc6 UTSW 4 101,468,461 (GRCm39) missense probably damaging 1.00
R4610:Dnajc6 UTSW 4 101,468,461 (GRCm39) missense probably damaging 1.00
R4755:Dnajc6 UTSW 4 101,407,996 (GRCm39) missense probably damaging 1.00
R4878:Dnajc6 UTSW 4 101,456,231 (GRCm39) intron probably benign
R4938:Dnajc6 UTSW 4 101,494,010 (GRCm39) missense probably damaging 1.00
R5373:Dnajc6 UTSW 4 101,472,824 (GRCm39) missense probably damaging 0.99
R5391:Dnajc6 UTSW 4 101,485,355 (GRCm39) critical splice donor site probably null
R5435:Dnajc6 UTSW 4 101,463,807 (GRCm39) missense probably damaging 0.99
R5760:Dnajc6 UTSW 4 101,475,839 (GRCm39) missense probably benign 0.39
R6044:Dnajc6 UTSW 4 101,473,774 (GRCm39) missense probably benign 0.22
R6086:Dnajc6 UTSW 4 101,455,004 (GRCm39) missense probably benign 0.45
R6460:Dnajc6 UTSW 4 101,472,795 (GRCm39) missense probably damaging 1.00
R6495:Dnajc6 UTSW 4 101,492,262 (GRCm39) nonsense probably null
R6956:Dnajc6 UTSW 4 101,471,470 (GRCm39) missense probably damaging 0.97
R7072:Dnajc6 UTSW 4 101,472,812 (GRCm39) missense probably damaging 1.00
R7155:Dnajc6 UTSW 4 101,470,142 (GRCm39) missense probably damaging 1.00
R7192:Dnajc6 UTSW 4 101,455,000 (GRCm39) missense probably benign 0.02
R7226:Dnajc6 UTSW 4 101,496,569 (GRCm39) missense probably damaging 1.00
R7298:Dnajc6 UTSW 4 101,463,808 (GRCm39) missense probably benign 0.09
R7612:Dnajc6 UTSW 4 101,455,123 (GRCm39) missense probably benign 0.40
R7622:Dnajc6 UTSW 4 101,497,688 (GRCm39) missense probably damaging 1.00
R7652:Dnajc6 UTSW 4 101,463,874 (GRCm39) missense probably damaging 0.98
R7789:Dnajc6 UTSW 4 101,475,729 (GRCm39) missense possibly damaging 0.82
R8010:Dnajc6 UTSW 4 101,475,611 (GRCm39) missense probably benign 0.01
R8201:Dnajc6 UTSW 4 101,475,960 (GRCm39) missense probably benign 0.08
R8305:Dnajc6 UTSW 4 101,480,984 (GRCm39) missense probably damaging 1.00
R8912:Dnajc6 UTSW 4 101,468,513 (GRCm39) missense probably damaging 1.00
R9012:Dnajc6 UTSW 4 101,470,156 (GRCm39) missense probably damaging 1.00
R9052:Dnajc6 UTSW 4 101,496,617 (GRCm39) missense probably damaging 0.97
R9091:Dnajc6 UTSW 4 101,496,559 (GRCm39) missense possibly damaging 0.80
R9160:Dnajc6 UTSW 4 101,470,258 (GRCm39) unclassified probably benign
R9258:Dnajc6 UTSW 4 101,475,813 (GRCm39) missense probably benign 0.07
R9270:Dnajc6 UTSW 4 101,496,559 (GRCm39) missense possibly damaging 0.80
R9294:Dnajc6 UTSW 4 101,408,054 (GRCm39) critical splice donor site probably null
R9386:Dnajc6 UTSW 4 101,494,098 (GRCm39) critical splice donor site probably null
R9664:Dnajc6 UTSW 4 101,475,821 (GRCm39) missense probably benign 0.04
Z1088:Dnajc6 UTSW 4 101,496,526 (GRCm39) missense probably damaging 1.00
Z1177:Dnajc6 UTSW 4 101,496,625 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCAGGCTTTCCCTGCAATGGATG -3'
(R):5'- GGTGCTTAGCACAGCATAACCTTGG -3'

Sequencing Primer
(F):5'- CCCTGCAATGGATGTTTCTG -3'
(R):5'- gaggcagaggcagccag -3'
Posted On 2014-03-14