Incidental Mutation 'R1421:Gm43302'
ID 159808
Institutional Source Beutler Lab
Gene Symbol Gm43302
Ensembl Gene ENSMUSG00000079362
Gene Name predicted gene 43302
Synonyms
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R1421 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 105362773-105441561 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 105365215 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 598 (T598A)
Ref Sequence ENSEMBL: ENSMUSP00000069042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000065588]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000050011
AA Change: T598A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362
AA Change: T598A

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065588
AA Change: T598A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000069042
Gene: ENSMUSG00000105096
AA Change: T598A

DomainStartEndE-ValueType
Pfam:GBP 16 279 5e-115 PFAM
Pfam:GBP_C 281 575 3.6e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196634
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Agtpbp1 A G 13: 59,643,389 (GRCm39) I717T possibly damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Atg16l1 T C 1: 87,714,080 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dnajc6 A T 4: 101,468,513 (GRCm39) Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Grhl2 A G 15: 37,309,960 (GRCm39) Y352C probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Ifitm2 T C 7: 140,534,972 (GRCm39) I121V probably benign Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lgals12 T C 19: 7,584,079 (GRCm39) H6R probably benign Het
Lrrc4b A G 7: 44,110,475 (GRCm39) I116V probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Slc6a12 T A 6: 121,336,085 (GRCm39) I352N probably damaging Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Ston1 T C 17: 88,943,221 (GRCm39) V209A probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Gm43302
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0033:Gm43302 UTSW 5 105,424,710 (GRCm39) missense probably benign 0.12
R0066:Gm43302 UTSW 5 105,438,766 (GRCm39) missense probably damaging 1.00
R0764:Gm43302 UTSW 5 105,428,355 (GRCm39) missense probably benign
R1400:Gm43302 UTSW 5 105,422,622 (GRCm39) missense probably damaging 1.00
R1539:Gm43302 UTSW 5 105,422,635 (GRCm39) missense probably benign 0.02
R1774:Gm43302 UTSW 5 105,423,660 (GRCm39) missense probably benign 0.01
R1842:Gm43302 UTSW 5 105,425,602 (GRCm39) missense probably benign 0.01
R2011:Gm43302 UTSW 5 105,438,846 (GRCm39) missense probably damaging 1.00
R2131:Gm43302 UTSW 5 105,422,610 (GRCm39) missense probably damaging 0.99
R2174:Gm43302 UTSW 5 105,422,216 (GRCm39) missense probably benign 0.12
R3687:Gm43302 UTSW 5 105,428,132 (GRCm39) missense probably damaging 1.00
R5322:Gm43302 UTSW 5 105,365,347 (GRCm39) missense probably benign 0.00
R5396:Gm43302 UTSW 5 105,427,955 (GRCm39) nonsense probably null
R5668:Gm43302 UTSW 5 105,423,678 (GRCm39) missense probably benign
R5723:Gm43302 UTSW 5 105,365,352 (GRCm39) missense possibly damaging 0.89
R6073:Gm43302 UTSW 5 105,438,825 (GRCm39) missense probably damaging 0.96
R6159:Gm43302 UTSW 5 105,436,894 (GRCm39) missense probably benign 0.11
R6225:Gm43302 UTSW 5 105,425,605 (GRCm39) nonsense probably null
R6483:Gm43302 UTSW 5 105,423,726 (GRCm39) missense probably benign 0.01
R6537:Gm43302 UTSW 5 105,438,861 (GRCm39) missense possibly damaging 0.94
R6678:Gm43302 UTSW 5 105,438,820 (GRCm39) missense probably benign 0.14
R6889:Gm43302 UTSW 5 105,428,004 (GRCm39) missense probably benign 0.00
R7163:Gm43302 UTSW 5 105,441,493 (GRCm39) splice site probably null
R7790:Gm43302 UTSW 5 105,425,691 (GRCm39) missense probably benign 0.03
R7893:Gm43302 UTSW 5 105,436,891 (GRCm39) nonsense probably null
R8047:Gm43302 UTSW 5 105,422,623 (GRCm39) missense possibly damaging 0.74
R8350:Gm43302 UTSW 5 105,422,573 (GRCm39) critical splice donor site probably null
R8450:Gm43302 UTSW 5 105,422,573 (GRCm39) critical splice donor site probably null
R8495:Gm43302 UTSW 5 105,424,570 (GRCm39) missense possibly damaging 0.79
R8728:Gm43302 UTSW 5 105,438,793 (GRCm39) missense probably benign 0.30
R8856:Gm43302 UTSW 5 105,438,739 (GRCm39) missense probably damaging 1.00
R8956:Gm43302 UTSW 5 105,425,602 (GRCm39) missense possibly damaging 0.79
R9009:Gm43302 UTSW 5 105,427,974 (GRCm39) missense probably benign 0.01
RF014:Gm43302 UTSW 5 105,422,623 (GRCm39) missense possibly damaging 0.94
Z1177:Gm43302 UTSW 5 105,424,662 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCATAGCTTCCATAGGGCTCATTTC -3'
(R):5'- TGGGCATGAACATAAGCACATCTTCAC -3'

Sequencing Primer
(F):5'- GGCTCATTTCAAAAATGTGTCCTC -3'
(R):5'- ATGCACTAAGGACTGCTTGC -3'
Posted On 2014-03-14