Incidental Mutation 'R1421:Slc6a12'
ID159809
Institutional Source Beutler Lab
Gene Symbol Slc6a12
Ensembl Gene ENSMUSG00000030109
Gene Namesolute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
SynonymsBGT1, Gabt2
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location121343076-121365775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121359126 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 352 (I352N)
Ref Sequence ENSEMBL: ENSMUSP00000126708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032200] [ENSMUST00000163771] [ENSMUST00000165456] [ENSMUST00000166390] [ENSMUST00000166457] [ENSMUST00000171008]
Predicted Effect probably damaging
Transcript: ENSMUST00000032200
AA Change: I366N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032200
Gene: ENSMUSG00000030109
AA Change: I366N

DomainStartEndE-ValueType
Pfam:SNF 50 575 2e-242 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163771
AA Change: I115N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127779
Gene: ENSMUSG00000030109
AA Change: I115N

DomainStartEndE-ValueType
Pfam:SNF 1 128 3.2e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165456
AA Change: H80Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130715
Gene: ENSMUSG00000030109
AA Change: H80Q

DomainStartEndE-ValueType
Pfam:SNF 1 49 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166390
SMART Domains Protein: ENSMUSP00000128217
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
low complexity region 35 52 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166457
AA Change: I352N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126937
Gene: ENSMUSG00000030109
AA Change: I352N

DomainStartEndE-ValueType
Pfam:SNF 36 561 2.5e-242 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170582
Predicted Effect probably damaging
Transcript: ENSMUST00000171008
AA Change: I352N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126708
Gene: ENSMUSG00000030109
AA Change: I352N

DomainStartEndE-ValueType
Pfam:SNF 36 518 1.5e-227 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171874
Meta Mutation Damage Score 0.8750 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal seizure threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Slc6a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Slc6a12 APN 6 121360455 missense probably damaging 1.00
IGL02066:Slc6a12 APN 6 121352056 missense probably damaging 0.97
IGL02146:Slc6a12 APN 6 121353501 missense probably benign 0.01
IGL02475:Slc6a12 APN 6 121354375 splice site probably null
IGL02498:Slc6a12 APN 6 121361070 missense probably benign
IGL02537:Slc6a12 APN 6 121360514 missense probably benign 0.00
IGL02696:Slc6a12 APN 6 121363252 missense probably benign 0.00
IGL03255:Slc6a12 APN 6 121354287 missense probably damaging 0.99
IGL03397:Slc6a12 APN 6 121357045 missense probably damaging 1.00
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0050:Slc6a12 UTSW 6 121360419 splice site probably benign
R0201:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0255:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0302:Slc6a12 UTSW 6 121363259 missense probably damaging 1.00
R0317:Slc6a12 UTSW 6 121358625 missense possibly damaging 0.80
R0394:Slc6a12 UTSW 6 121346998 critical splice donor site probably null
R0492:Slc6a12 UTSW 6 121355372 missense probably benign 0.03
R0532:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0550:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R0551:Slc6a12 UTSW 6 121356918 missense probably damaging 1.00
R1487:Slc6a12 UTSW 6 121363757 nonsense probably null
R1879:Slc6a12 UTSW 6 121347423 missense probably damaging 1.00
R1905:Slc6a12 UTSW 6 121347443 nonsense probably null
R1925:Slc6a12 UTSW 6 121360526 missense probably benign 0.44
R3944:Slc6a12 UTSW 6 121354280 critical splice acceptor site probably null
R4515:Slc6a12 UTSW 6 121353530 critical splice donor site probably null
R4559:Slc6a12 UTSW 6 121363861 splice site probably null
R4628:Slc6a12 UTSW 6 121351992 nonsense probably null
R4665:Slc6a12 UTSW 6 121359013 splice site probably benign
R4753:Slc6a12 UTSW 6 121356903 splice site probably benign
R4948:Slc6a12 UTSW 6 121355322 missense probably benign 0.35
R5517:Slc6a12 UTSW 6 121354339 missense probably benign 0.10
R6717:Slc6a12 UTSW 6 121354303 missense probably benign 0.01
R7139:Slc6a12 UTSW 6 121365319 missense probably benign
R7318:Slc6a12 UTSW 6 121352013 missense probably damaging 0.99
R7318:Slc6a12 UTSW 6 121352019 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GTTTGTGTTGCCTGTGCCATATCAC -3'
(R):5'- GCTGTTCGAAGGAAACAAGTTCAACTC -3'

Sequencing Primer
(F):5'- tctttctgtttcttgttcccttc -3'
(R):5'- tctctccctccctctctcc -3'
Posted On2014-03-14