Incidental Mutation 'R1421:Slc6a12'
ID 159809
Institutional Source Beutler Lab
Gene Symbol Slc6a12
Ensembl Gene ENSMUSG00000030109
Gene Name solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms Gabt2, BGT1
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1421 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 121320035-121342734 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121336085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 352 (I352N)
Ref Sequence ENSEMBL: ENSMUSP00000126708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032200] [ENSMUST00000163771] [ENSMUST00000165456] [ENSMUST00000166390] [ENSMUST00000166457] [ENSMUST00000171008]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032200
AA Change: I366N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032200
Gene: ENSMUSG00000030109
AA Change: I366N

DomainStartEndE-ValueType
Pfam:SNF 50 575 2e-242 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163771
AA Change: I115N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127779
Gene: ENSMUSG00000030109
AA Change: I115N

DomainStartEndE-ValueType
Pfam:SNF 1 128 3.2e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165456
AA Change: H80Q

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130715
Gene: ENSMUSG00000030109
AA Change: H80Q

DomainStartEndE-ValueType
Pfam:SNF 1 49 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166390
SMART Domains Protein: ENSMUSP00000128217
Gene: ENSMUSG00000030109

DomainStartEndE-ValueType
low complexity region 35 52 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166457
AA Change: I352N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126937
Gene: ENSMUSG00000030109
AA Change: I352N

DomainStartEndE-ValueType
Pfam:SNF 36 561 2.5e-242 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170339
Predicted Effect probably damaging
Transcript: ENSMUST00000171008
AA Change: I352N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126708
Gene: ENSMUSG00000030109
AA Change: I352N

DomainStartEndE-ValueType
Pfam:SNF 36 518 1.5e-227 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170582
Meta Mutation Damage Score 0.8750 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit normal seizure threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Agtpbp1 A G 13: 59,643,389 (GRCm39) I717T possibly damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Atg16l1 T C 1: 87,714,080 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dnajc6 A T 4: 101,468,513 (GRCm39) Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Gm43302 T C 5: 105,365,215 (GRCm39) T598A probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Grhl2 A G 15: 37,309,960 (GRCm39) Y352C probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Ifitm2 T C 7: 140,534,972 (GRCm39) I121V probably benign Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lgals12 T C 19: 7,584,079 (GRCm39) H6R probably benign Het
Lrrc4b A G 7: 44,110,475 (GRCm39) I116V probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Ston1 T C 17: 88,943,221 (GRCm39) V209A probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Slc6a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Slc6a12 APN 6 121,337,414 (GRCm39) missense probably damaging 1.00
IGL02066:Slc6a12 APN 6 121,329,015 (GRCm39) missense probably damaging 0.97
IGL02146:Slc6a12 APN 6 121,330,460 (GRCm39) missense probably benign 0.01
IGL02475:Slc6a12 APN 6 121,331,334 (GRCm39) splice site probably null
IGL02498:Slc6a12 APN 6 121,338,029 (GRCm39) missense probably benign
IGL02537:Slc6a12 APN 6 121,337,473 (GRCm39) missense probably benign 0.00
IGL02696:Slc6a12 APN 6 121,340,211 (GRCm39) missense probably benign 0.00
IGL03255:Slc6a12 APN 6 121,331,246 (GRCm39) missense probably damaging 0.99
IGL03397:Slc6a12 APN 6 121,334,004 (GRCm39) missense probably damaging 1.00
R0050:Slc6a12 UTSW 6 121,337,378 (GRCm39) splice site probably benign
R0050:Slc6a12 UTSW 6 121,337,378 (GRCm39) splice site probably benign
R0201:Slc6a12 UTSW 6 121,332,331 (GRCm39) missense probably benign 0.03
R0255:Slc6a12 UTSW 6 121,333,877 (GRCm39) missense probably damaging 1.00
R0302:Slc6a12 UTSW 6 121,340,218 (GRCm39) missense probably damaging 1.00
R0317:Slc6a12 UTSW 6 121,335,584 (GRCm39) missense possibly damaging 0.80
R0394:Slc6a12 UTSW 6 121,323,957 (GRCm39) critical splice donor site probably null
R0492:Slc6a12 UTSW 6 121,332,331 (GRCm39) missense probably benign 0.03
R0532:Slc6a12 UTSW 6 121,333,877 (GRCm39) missense probably damaging 1.00
R0550:Slc6a12 UTSW 6 121,333,877 (GRCm39) missense probably damaging 1.00
R0551:Slc6a12 UTSW 6 121,333,877 (GRCm39) missense probably damaging 1.00
R1487:Slc6a12 UTSW 6 121,340,716 (GRCm39) nonsense probably null
R1879:Slc6a12 UTSW 6 121,324,382 (GRCm39) missense probably damaging 1.00
R1905:Slc6a12 UTSW 6 121,324,402 (GRCm39) nonsense probably null
R1925:Slc6a12 UTSW 6 121,337,485 (GRCm39) missense probably benign 0.44
R3944:Slc6a12 UTSW 6 121,331,239 (GRCm39) critical splice acceptor site probably null
R4515:Slc6a12 UTSW 6 121,330,489 (GRCm39) critical splice donor site probably null
R4559:Slc6a12 UTSW 6 121,340,820 (GRCm39) splice site probably null
R4628:Slc6a12 UTSW 6 121,328,951 (GRCm39) nonsense probably null
R4665:Slc6a12 UTSW 6 121,335,972 (GRCm39) splice site probably benign
R4753:Slc6a12 UTSW 6 121,333,862 (GRCm39) splice site probably benign
R4948:Slc6a12 UTSW 6 121,332,281 (GRCm39) missense probably benign 0.35
R5517:Slc6a12 UTSW 6 121,331,298 (GRCm39) missense probably benign 0.10
R6717:Slc6a12 UTSW 6 121,331,262 (GRCm39) missense probably benign 0.01
R7139:Slc6a12 UTSW 6 121,342,278 (GRCm39) missense probably benign
R7318:Slc6a12 UTSW 6 121,328,978 (GRCm39) missense probably benign 0.26
R7318:Slc6a12 UTSW 6 121,328,972 (GRCm39) missense probably damaging 0.99
R8310:Slc6a12 UTSW 6 121,340,250 (GRCm39) missense probably damaging 1.00
R8703:Slc6a12 UTSW 6 121,324,447 (GRCm39) missense probably benign
R9218:Slc6a12 UTSW 6 121,335,623 (GRCm39) missense probably damaging 1.00
R9648:Slc6a12 UTSW 6 121,335,661 (GRCm39) nonsense probably null
R9682:Slc6a12 UTSW 6 121,340,704 (GRCm39) missense probably benign
Z1176:Slc6a12 UTSW 6 121,340,786 (GRCm39) missense probably benign
Z1177:Slc6a12 UTSW 6 121,342,231 (GRCm39) missense probably benign 0.02
Z1177:Slc6a12 UTSW 6 121,333,926 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTTTGTGTTGCCTGTGCCATATCAC -3'
(R):5'- GCTGTTCGAAGGAAACAAGTTCAACTC -3'

Sequencing Primer
(F):5'- tctttctgtttcttgttcccttc -3'
(R):5'- tctctccctccctctctcc -3'
Posted On 2014-03-14