Incidental Mutation 'R1421:Gramd1a'
ID159812
Institutional Source Beutler Lab
Gene Symbol Gramd1a
Ensembl Gene ENSMUSG00000001248
Gene NameGRAM domain containing 1A
SynonymsD7Bwg0611e, 1300003M23Rik
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location31130127-31155896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31142866 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 90 (Q90L)
Ref Sequence ENSEMBL: ENSMUSP00000139681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001280] [ENSMUST00000085636] [ENSMUST00000185514] [ENSMUST00000186634] [ENSMUST00000186723] [ENSMUST00000187679]
Predicted Effect probably benign
Transcript: ENSMUST00000001280
AA Change: Q90L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000001280
Gene: ENSMUSG00000001248
AA Change: Q90L

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 520 7.3e-37 PFAM
low complexity region 531 542 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
transmembrane domain 606 628 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085636
AA Change: Q90L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000082778
Gene: ENSMUSG00000001248
AA Change: Q90L

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 2.54e-29 SMART
low complexity region 342 360 N/A INTRINSIC
Pfam:DUF4782 372 500 1.1e-28 PFAM
low complexity region 514 528 N/A INTRINSIC
transmembrane domain 572 594 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185514
AA Change: Q90L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139681
Gene: ENSMUSG00000001248
AA Change: Q90L

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185985
Predicted Effect probably benign
Transcript: ENSMUST00000186634
AA Change: Q90L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000140195
Gene: ENSMUSG00000001248
AA Change: Q90L

DomainStartEndE-ValueType
low complexity region 8 39 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
GRAM 93 160 8.9e-32 SMART
low complexity region 342 360 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000186723
AA Change: Q171L

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139709
Gene: ENSMUSG00000001248
AA Change: Q171L

DomainStartEndE-ValueType
low complexity region 89 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
Pfam:GRAM 174 208 1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187679
AA Change: Q49L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000140674
Gene: ENSMUSG00000001248
AA Change: Q49L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
GRAM 52 119 8.9e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188032
Predicted Effect probably benign
Transcript: ENSMUST00000202814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205298
Predicted Effect probably benign
Transcript: ENSMUST00000206233
Predicted Effect probably benign
Transcript: ENSMUST00000206432
Meta Mutation Damage Score 0.1596 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Gramd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Gramd1a APN 7 31142568 missense probably damaging 0.99
IGL01627:Gramd1a APN 7 31139796 missense probably damaging 0.99
IGL01684:Gramd1a APN 7 31138905 missense possibly damaging 0.67
IGL01793:Gramd1a APN 7 31134413 critical splice donor site probably null
IGL01986:Gramd1a APN 7 31134009 missense possibly damaging 0.58
IGL02029:Gramd1a APN 7 31132824 missense possibly damaging 0.95
IGL02060:Gramd1a APN 7 31130571 nonsense probably null
IGL02569:Gramd1a APN 7 31130507 unclassified probably benign
IGL02606:Gramd1a APN 7 31134515 missense probably damaging 1.00
IGL02715:Gramd1a APN 7 31135854 missense probably damaging 1.00
IGL03253:Gramd1a APN 7 31139846 nonsense probably null
PIT4377001:Gramd1a UTSW 7 31143670 missense possibly damaging 0.95
PIT4618001:Gramd1a UTSW 7 31132596 missense probably benign 0.00
R0179:Gramd1a UTSW 7 31142418 missense probably damaging 1.00
R0329:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0330:Gramd1a UTSW 7 31138254 missense possibly damaging 0.93
R0628:Gramd1a UTSW 7 31142624 missense probably damaging 1.00
R0834:Gramd1a UTSW 7 31138164 missense possibly damaging 0.94
R1430:Gramd1a UTSW 7 31132786 missense probably damaging 0.97
R1682:Gramd1a UTSW 7 31142900 splice site probably null
R1703:Gramd1a UTSW 7 31139534 missense possibly damaging 0.96
R1822:Gramd1a UTSW 7 31142573 missense probably damaging 1.00
R2308:Gramd1a UTSW 7 31139790 missense probably damaging 0.97
R3861:Gramd1a UTSW 7 31135940 missense possibly damaging 0.90
R4184:Gramd1a UTSW 7 31132515 intron probably benign
R4908:Gramd1a UTSW 7 31138867 missense probably benign 0.27
R4978:Gramd1a UTSW 7 31132788 missense possibly damaging 0.74
R5723:Gramd1a UTSW 7 31134483 missense probably damaging 1.00
R5927:Gramd1a UTSW 7 31139821 missense probably benign 0.33
R6466:Gramd1a UTSW 7 31143796 missense probably benign
R6838:Gramd1a UTSW 7 31134504 missense probably benign 0.30
R7034:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7036:Gramd1a UTSW 7 31132756 critical splice donor site probably null
R7867:Gramd1a UTSW 7 31143567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAGAACTAGCCAGAAGCCCTG -3'
(R):5'- GGTATGTGTGTTGTGAGCAAAGAAGCC -3'

Sequencing Primer
(F):5'- GCTGTAGAAACAGATCCAGTTCTC -3'
(R):5'- CCCAAGGGCCGAGAAGAC -3'
Posted On2014-03-14