Incidental Mutation 'R1421:Lrrc4b'
ID 159813
Institutional Source Beutler Lab
Gene Symbol Lrrc4b
Ensembl Gene ENSMUSG00000047085
Gene Name leucine rich repeat containing 4B
Synonyms NGL-3, Lrig4, Ngl3
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R1421 (G1)
Quality Score 109
Status Validated
Chromosome 7
Chromosomal Location 44091911-44112775 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 44110475 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 116 (I116V)
Ref Sequence ENSEMBL: ENSMUSP00000123389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035929] [ENSMUST00000058667] [ENSMUST00000127790] [ENSMUST00000135624] [ENSMUST00000146128] [ENSMUST00000156093] [ENSMUST00000152902]
AlphaFold P0C192
Predicted Effect probably benign
Transcript: ENSMUST00000035929
SMART Domains Protein: ENSMUSP00000039202
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 17 128 3.8e-24 PFAM
Pfam:DUF108 174 265 2.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058667
AA Change: I116V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000053123
Gene: ENSMUSG00000047085
AA Change: I116V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
LRR 208 229 1.62e2 SMART
LRR_TYP 230 253 3.63e-3 SMART
LRR 254 277 9.75e0 SMART
LRR_TYP 278 301 5.29e-5 SMART
LRRCT 313 364 1.92e-3 SMART
IGc2 378 445 1.45e-9 SMART
low complexity region 462 482 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 624 644 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127790
AA Change: I116V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123389
Gene: ENSMUSG00000047085
AA Change: I116V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133801
Predicted Effect probably benign
Transcript: ENSMUST00000135624
Predicted Effect probably benign
Transcript: ENSMUST00000146128
SMART Domains Protein: ENSMUSP00000119474
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 5 110 1e-19 PFAM
Pfam:DUF108 153 252 7.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156093
AA Change: I116V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119374
Gene: ENSMUSG00000047085
AA Change: I116V

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
LRR 208 230 3.65e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152902
Meta Mutation Damage Score 0.0951 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Agtpbp1 A G 13: 59,643,389 (GRCm39) I717T possibly damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Atg16l1 T C 1: 87,714,080 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dnajc6 A T 4: 101,468,513 (GRCm39) Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Gm43302 T C 5: 105,365,215 (GRCm39) T598A probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Grhl2 A G 15: 37,309,960 (GRCm39) Y352C probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Ifitm2 T C 7: 140,534,972 (GRCm39) I121V probably benign Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lgals12 T C 19: 7,584,079 (GRCm39) H6R probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Slc6a12 T A 6: 121,336,085 (GRCm39) I352N probably damaging Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Ston1 T C 17: 88,943,221 (GRCm39) V209A probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Lrrc4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0165:Lrrc4b UTSW 7 44,111,739 (GRCm39) missense probably damaging 0.99
R1398:Lrrc4b UTSW 7 44,111,876 (GRCm39) missense probably benign 0.44
R1622:Lrrc4b UTSW 7 44,111,654 (GRCm39) unclassified probably benign
R1681:Lrrc4b UTSW 7 44,110,601 (GRCm39) missense probably damaging 0.99
R1778:Lrrc4b UTSW 7 44,111,823 (GRCm39) missense probably benign
R1967:Lrrc4b UTSW 7 44,111,654 (GRCm39) unclassified probably benign
R1989:Lrrc4b UTSW 7 44,111,654 (GRCm39) unclassified probably benign
R2427:Lrrc4b UTSW 7 44,111,976 (GRCm39) missense probably damaging 1.00
R3820:Lrrc4b UTSW 7 44,111,982 (GRCm39) missense probably damaging 1.00
R3822:Lrrc4b UTSW 7 44,111,982 (GRCm39) missense probably damaging 1.00
R4774:Lrrc4b UTSW 7 44,111,796 (GRCm39) splice site probably null
R5249:Lrrc4b UTSW 7 44,111,988 (GRCm39) missense possibly damaging 0.93
R5268:Lrrc4b UTSW 7 44,110,787 (GRCm39) missense probably damaging 1.00
R6029:Lrrc4b UTSW 7 44,111,754 (GRCm39) missense probably benign 0.00
R6984:Lrrc4b UTSW 7 44,110,722 (GRCm39) missense possibly damaging 0.62
R7003:Lrrc4b UTSW 7 44,094,580 (GRCm39) missense probably damaging 1.00
R7392:Lrrc4b UTSW 7 44,111,439 (GRCm39) missense probably damaging 1.00
R7544:Lrrc4b UTSW 7 44,111,975 (GRCm39) missense probably damaging 1.00
R7582:Lrrc4b UTSW 7 44,111,234 (GRCm39) missense probably benign 0.00
R7596:Lrrc4b UTSW 7 44,111,310 (GRCm39) missense probably damaging 1.00
R7830:Lrrc4b UTSW 7 44,111,231 (GRCm39) missense possibly damaging 0.76
R7836:Lrrc4b UTSW 7 44,094,316 (GRCm39) start gained probably benign
R8116:Lrrc4b UTSW 7 44,110,533 (GRCm39) missense probably damaging 1.00
R8147:Lrrc4b UTSW 7 44,111,829 (GRCm39) missense probably damaging 1.00
R8376:Lrrc4b UTSW 7 44,112,018 (GRCm39) missense probably benign 0.00
R9226:Lrrc4b UTSW 7 44,112,099 (GRCm39) missense possibly damaging 0.85
R9674:Lrrc4b UTSW 7 44,111,852 (GRCm39) missense probably damaging 1.00
Z1176:Lrrc4b UTSW 7 44,110,736 (GRCm39) frame shift probably null
Z1176:Lrrc4b UTSW 7 44,094,547 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc4b UTSW 7 44,111,335 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc4b UTSW 7 44,094,404 (GRCm39) missense unknown
Z1177:Lrrc4b UTSW 7 44,094,403 (GRCm39) missense unknown
Z1177:Lrrc4b UTSW 7 44,112,041 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCCACGTAGTGAGCCTCCTC -3'
(R):5'- CCGCCTCAGATATGTACTCCAGCC -3'

Sequencing Primer
(F):5'- tgggaatgaaggataatggtagag -3'
(R):5'- AGATATGTACTCCAGCCTCTTCAG -3'
Posted On 2014-03-14