Incidental Mutation 'R1421:Ifitm2'
ID 159816
Institutional Source Beutler Lab
Gene Symbol Ifitm2
Ensembl Gene ENSMUSG00000060591
Gene Name interferon induced transmembrane protein 2
Synonyms mil-3, fragilis3, Ifitm3l
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R1421 (G1)
Quality Score 141
Status Validated
Chromosome 7
Chromosomal Location 140534750-140535900 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 140534972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 121 (I121V)
Ref Sequence ENSEMBL: ENSMUSP00000071470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026562] [ENSMUST00000081649] [ENSMUST00000211129]
AlphaFold Q99J93
Predicted Effect probably benign
Transcript: ENSMUST00000026562
SMART Domains Protein: ENSMUSP00000026562
Gene: ENSMUSG00000025489

DomainStartEndE-ValueType
Pfam:CD225 26 102 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081649
AA Change: I121V

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000071470
Gene: ENSMUSG00000060591
AA Change: I121V

DomainStartEndE-ValueType
Pfam:CD225 46 120 6.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211129
Meta Mutation Damage Score 0.2402 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Agtpbp1 A G 13: 59,643,389 (GRCm39) I717T possibly damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Atg16l1 T C 1: 87,714,080 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dnajc6 A T 4: 101,468,513 (GRCm39) Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Gm43302 T C 5: 105,365,215 (GRCm39) T598A probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Grhl2 A G 15: 37,309,960 (GRCm39) Y352C probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lgals12 T C 19: 7,584,079 (GRCm39) H6R probably benign Het
Lrrc4b A G 7: 44,110,475 (GRCm39) I116V probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Slc6a12 T A 6: 121,336,085 (GRCm39) I352N probably damaging Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Ston1 T C 17: 88,943,221 (GRCm39) V209A probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Ifitm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03213:Ifitm2 APN 7 140,535,677 (GRCm39) missense possibly damaging 0.91
R0546:Ifitm2 UTSW 7 140,535,656 (GRCm39) missense possibly damaging 0.94
R2306:Ifitm2 UTSW 7 140,535,702 (GRCm39) missense probably damaging 1.00
R8772:Ifitm2 UTSW 7 140,535,803 (GRCm39) missense probably benign 0.43
R8795:Ifitm2 UTSW 7 140,535,661 (GRCm39) missense probably damaging 0.98
R9174:Ifitm2 UTSW 7 140,535,013 (GRCm39) missense probably damaging 1.00
R9294:Ifitm2 UTSW 7 140,535,814 (GRCm39) frame shift probably null
R9336:Ifitm2 UTSW 7 140,535,814 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCACTGTGGACAGATAGGTGAAGG -3'
(R):5'- TGCAGCGAATGCTGGAGCTTAC -3'

Sequencing Primer
(F):5'- GTGAAGGTAACATTTGCATACGC -3'
(R):5'- AATGGAGCCAGAGCACCTG -3'
Posted On 2014-03-14