Incidental Mutation 'R1421:Gcm1'
Institutional Source Beutler Lab
Gene Symbol Gcm1
Ensembl Gene ENSMUSG00000023333
Gene Nameglial cells missing homolog 1
Synonymsglide, GCMa, Gcm a, Gcm 1, Gcm1-rs1, glial cell deficient
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosomal Location78051924-78065624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78059700 bp
Amino Acid Change Histidine to Leucine at position 67 (H67L)
Ref Sequence ENSEMBL: ENSMUSP00000024104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024104]
Predicted Effect probably damaging
Transcript: ENSMUST00000024104
AA Change: H67L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024104
Gene: ENSMUSG00000023333
AA Change: H67L

Pfam:GCM 30 167 4.2e-75 PFAM
Meta Mutation Damage Score 0.9418 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein with a gcm-motif (glial cell missing motif). The encoded protein is a homolog of the Drosophila glial cells missing gene (gcm). This protein binds to the GCM-motif (A/G)CCCGCAT, a novel sequence among known targets of DNA-binding proteins. The N-terminal DNA-binding domain confers the unique DNA-binding activity of this protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired branching of the chorioallantoic interface, absence of the placental labyrinth, lack of fusion of chorionic trophoblast cells, and lethality between embryonic days 5.5-10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Gcm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Gcm1 APN 9 78065016 missense probably benign 0.09
IGL02132:Gcm1 APN 9 78064839 missense possibly damaging 0.95
IGL02820:Gcm1 APN 9 78064562 missense probably benign
IGL03074:Gcm1 APN 9 78064775 missense possibly damaging 0.84
PIT4280001:Gcm1 UTSW 9 78059633 missense probably damaging 1.00
R0720:Gcm1 UTSW 9 78064641 missense possibly damaging 0.68
R1271:Gcm1 UTSW 9 78059577 missense probably benign 0.05
R1481:Gcm1 UTSW 9 78059717 nonsense probably null
R1884:Gcm1 UTSW 9 78059579 missense probably benign 0.01
R1907:Gcm1 UTSW 9 78064773 missense probably benign 0.00
R2029:Gcm1 UTSW 9 78065044 missense possibly damaging 0.70
R2160:Gcm1 UTSW 9 78061380 missense probably benign 0.05
R3103:Gcm1 UTSW 9 78064452 missense probably damaging 0.98
R3944:Gcm1 UTSW 9 78059816 nonsense probably null
R5292:Gcm1 UTSW 9 78061426 missense probably damaging 1.00
R5769:Gcm1 UTSW 9 78064967 missense probably benign
R6446:Gcm1 UTSW 9 78059783 missense probably benign 0.08
R6465:Gcm1 UTSW 9 78064869 missense probably damaging 0.99
R7114:Gcm1 UTSW 9 78059779 missense probably damaging 1.00
R7212:Gcm1 UTSW 9 78059643 missense possibly damaging 0.84
R7398:Gcm1 UTSW 9 78064679 missense probably benign 0.00
R7584:Gcm1 UTSW 9 78064467 missense possibly damaging 0.62
R8130:Gcm1 UTSW 9 78064534 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- catccaagaccatcagaaaacac -3'
Posted On2014-03-14