Mutagenetix > Incidental Mutation

Incidental Mutation 'R1421:Zfp735'

159824

Institutional Source

Beutler Lab

Gene Symbol

Zfp735

Ensembl Gene

ENSMUSG00000060630

Gene Name

zinc finger protein 735

Synonyms

1700012C15Rik

MMRRC Submission

039477-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R1421 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73688778-73713798 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 73710697 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 156 (L156I)

Ref Sequence

ENSEMBL: ENSMUSP00000079269 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080407]

AlphaFold

B1ARH2

Predicted Effect

probably benign
Transcript: ENSMUST00000080407
AA Change: L156I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: L156I

Domain	Start	End	E-Value	Type
KRAB	8	68	2.2e-34	SMART
ZnF_C2H2	483	505	4.38e1	SMART
ZnF_C2H2	511	533	2.67e-1	SMART
ZnF_C2H2	539	561	1.81e1	SMART
ZnF_C2H2	567	589	1.5e-4	SMART
ZnF_C2H2	595	617	4.87e-4	SMART
ZnF_C2H2	623	645	4.24e-4	SMART
ZnF_C2H2	651	673	2.27e-4	SMART
ZnF_C2H2	679	701	7.49e-5	SMART
ZnF_C2H2	707	729	4.87e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149560

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

96% (54/56)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	A	G	10: 116,113,438	V61A	probably damaging	Het
A2ml1	T	C	6: 128,543,960	T1344A	probably benign	Het
Abcf1	G	A	17: 35,960,909	A375V	probably damaging	Het
Adam20	T	A	8: 40,796,747	H631Q	possibly damaging	Het
Adcy10	T	C	1: 165,563,947	S1258P	probably damaging	Het
Agtpbp1	A	G	13: 59,495,575	I717T	possibly damaging	Het
Ahnak	T	A	19: 9,015,631	F4760I	possibly damaging	Het
Ano6	A	G	15: 95,913,385	K122R	probably benign	Het
Arhgap5	T	C	12: 52,516,848	C201R	probably damaging	Het
Atg16l1	T	C	1: 87,786,358		probably benign	Het
Cdhr3	A	T	12: 33,060,292	I331K	probably damaging	Het
Coq8a	A	G	1: 180,170,441		probably benign	Het
Crebbp	A	G	16: 4,124,647	V662A	probably damaging	Het
Cspg4	T	A	9: 56,896,626	M1667K	probably benign	Het
Dnah7a	A	G	1: 53,540,873		probably benign	Het
Dnajc6	A	T	4: 101,611,316	Y251F	probably damaging	Het
Dpy19l4	A	T	4: 11,304,011	M133K	probably benign	Het
Emb	T	C	13: 117,272,088	Y322H	probably benign	Het
Fam196a	A	T	7: 134,899,231		probably benign	Het
Gcm1	A	T	9: 78,059,700	H67L	probably damaging	Het
Gls2	A	T	10: 128,201,348	K253*	probably null	Het
Gm28042	T	A	2: 120,036,463	S196T	probably benign	Het
Gm43302	T	C	5: 105,217,349	T598A	probably benign	Het
Gramd1a	T	A	7: 31,142,866	Q90L	probably damaging	Het
Grhl2	A	G	15: 37,309,716	Y352C	probably damaging	Het
Ifi203-ps	T	C	1: 173,797,997		noncoding transcript	Het
Ifitm2	T	C	7: 140,955,059	I121V	probably benign	Het
Kptn	T	G	7: 16,123,024		probably benign	Het
L2hgdh	C	T	12: 69,701,318	D345N	probably benign	Het
Lgals12	T	C	19: 7,606,714	H6R	probably benign	Het
Lrrc4b	A	G	7: 44,461,051	I116V	probably benign	Het
Misp	A	G	10: 79,826,847	D366G	probably damaging	Het
Nav1	T	C	1: 135,585,010	E104G	probably damaging	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Parp1	T	C	1: 180,600,088		probably benign	Het
Pikfyve	G	A	1: 65,271,311	G1919D	probably damaging	Het
Pomt1	A	G	2: 32,236,753		probably benign	Het
Prrc2b	C	T	2: 32,200,978	S454F	possibly damaging	Het
Selenbp1	T	C	3: 94,943,872	S360P	probably benign	Het
Slc6a12	T	A	6: 121,359,126	I352N	probably damaging	Het
Snx9	G	A	17: 5,902,484	G197D	probably benign	Het
Ston1	T	C	17: 88,635,793	V209A	probably benign	Het
Tex36	A	T	7: 133,595,349		probably null	Het
Tnnt3	A	G	7: 142,511,366	E108G	probably damaging	Het
Vmn2r98	T	A	17: 19,065,178	F87I	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wdr64	T	C	1: 175,767,150	I479T	possibly damaging	Het
Xrcc5	A	G	1: 72,310,477	N22D	probably benign	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp820	A	T	17: 21,819,880	Y156N	possibly damaging	Het

Other mutations in Zfp735

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Zfp735	APN	11	73711366	missense	possibly damaging	0.86
IGL00798:Zfp735	APN	11	73711560	missense	possibly damaging	0.72
IGL01642:Zfp735	APN	11	73710479	missense	possibly damaging	0.73
IGL01684:Zfp735	APN	11	73690365	missense	possibly damaging	0.86
IGL02096:Zfp735	APN	11	73711428	missense	probably benign	0.01
IGL02238:Zfp735	APN	11	73710493	missense	probably benign	0.00
IGL02505:Zfp735	APN	11	73689800	missense	probably benign	0.03
IGL02740:Zfp735	APN	11	73710586	missense	possibly damaging	0.53
IGL02957:Zfp735	APN	11	73710929	missense	probably benign	0.00
bananaquit	UTSW	11	73710586	nonsense	probably null
bescher	UTSW	11	73712153	missense	possibly damaging	0.93
Galvanic	UTSW	11	73711678	nonsense	probably null
grassquit	UTSW	11	73712203	missense	possibly damaging	0.66
R0114:Zfp735	UTSW	11	73710662	missense	probably benign	0.33
R0217:Zfp735	UTSW	11	73711286	missense	possibly damaging	0.73
R0943:Zfp735	UTSW	11	73712083	missense	probably benign	0.04
R1460:Zfp735	UTSW	11	73712333	missense	possibly damaging	0.73
R1493:Zfp735	UTSW	11	73710479	missense	possibly damaging	0.73
R1517:Zfp735	UTSW	11	73710644	missense	probably benign
R1676:Zfp735	UTSW	11	73711475	missense	possibly damaging	0.53
R1709:Zfp735	UTSW	11	73711763	missense	probably benign	0.01
R1871:Zfp735	UTSW	11	73710586	nonsense	probably null
R1931:Zfp735	UTSW	11	73711851	missense	possibly damaging	0.69
R2219:Zfp735	UTSW	11	73711025	missense	possibly damaging	0.53
R2227:Zfp735	UTSW	11	73711396	missense	possibly damaging	0.53
R2227:Zfp735	UTSW	11	73711397	nonsense	probably null
R3552:Zfp735	UTSW	11	73711241	nonsense	probably null
R3856:Zfp735	UTSW	11	73711456	missense	probably benign	0.01
R3925:Zfp735	UTSW	11	73711124	missense	probably benign	0.33
R4572:Zfp735	UTSW	11	73689785	missense	probably benign	0.02
R4585:Zfp735	UTSW	11	73689724	missense	possibly damaging	0.51
R4586:Zfp735	UTSW	11	73689724	missense	possibly damaging	0.51
R4619:Zfp735	UTSW	11	73711205	missense	probably damaging	0.98
R4687:Zfp735	UTSW	11	73711855	missense	probably damaging	0.98
R4687:Zfp735	UTSW	11	73711856	missense	probably damaging	0.98
R5435:Zfp735	UTSW	11	73712113	missense	possibly damaging	0.72
R5489:Zfp735	UTSW	11	73710593	nonsense	probably null
R5516:Zfp735	UTSW	11	73710814	missense	probably benign
R5654:Zfp735	UTSW	11	73712138	missense	possibly damaging	0.71
R5990:Zfp735	UTSW	11	73690348	missense	possibly damaging	0.70
R6332:Zfp735	UTSW	11	73711678	nonsense	probably null
R6427:Zfp735	UTSW	11	73690314	missense	possibly damaging	0.73
R6460:Zfp735	UTSW	11	73711652	missense	probably benign	0.33
R6820:Zfp735	UTSW	11	73688957	start codon destroyed	probably null	0.01
R6831:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6833:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6834:Zfp735	UTSW	11	73710608	missense	probably damaging	1.00
R6897:Zfp735	UTSW	11	73711054	missense	probably benign	0.08
R6941:Zfp735	UTSW	11	73690333	missense	probably benign	0.33
R7335:Zfp735	UTSW	11	73711553	missense	possibly damaging	0.47
R7366:Zfp735	UTSW	11	73712153	missense	possibly damaging	0.93
R7474:Zfp735	UTSW	11	73711176	missense	possibly damaging	0.72
R7487:Zfp735	UTSW	11	73690328	missense	possibly damaging	0.53
R7583:Zfp735	UTSW	11	73711107	missense	possibly damaging	0.86
R7866:Zfp735	UTSW	11	73710803	missense	probably benign	0.00
R8005:Zfp735	UTSW	11	73712314	nonsense	probably null
R8500:Zfp735	UTSW	11	73710985	missense	possibly damaging	0.53
R8551:Zfp735	UTSW	11	73712296	missense	probably benign	0.06
R8754:Zfp735	UTSW	11	73712174	missense	possibly damaging	0.85
R8769:Zfp735	UTSW	11	73690301	missense	possibly damaging	0.53
R8794:Zfp735	UTSW	11	73712203	missense	possibly damaging	0.66
R8835:Zfp735	UTSW	11	73710866	missense	possibly damaging	0.53
R8869:Zfp735	UTSW	11	73711684	missense	possibly damaging	0.53
R8969:Zfp735	UTSW	11	73711873	missense	possibly damaging	0.83
R9072:Zfp735	UTSW	11	73712234	missense	probably benign	0.21
R9073:Zfp735	UTSW	11	73712234	missense	probably benign	0.21
R9193:Zfp735	UTSW	11	73689774	missense	possibly damaging	0.71
R9355:Zfp735	UTSW	11	73711536	missense	probably benign	0.01
R9414:Zfp735	UTSW	11	73711197	nonsense	probably null
R9456:Zfp735	UTSW	11	73711577	missense	possibly damaging	0.53
R9573:Zfp735	UTSW	11	73712110	missense	possibly damaging	0.67
R9647:Zfp735	UTSW	11	73689774	missense	probably damaging	0.98
R9710:Zfp735	UTSW	11	73710980	missense	possibly damaging	0.86
Z1176:Zfp735	UTSW	11	73710815	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TCTTGGAACAAAGTGATGCACTTCTGT -3'
(R):5'- CCCACAACTGCTTCCCATGTGA -3'

Sequencing Primer
(F):5'- CCAAGAAGCTATTACCAAAGGTGTG -3'
(R):5'- GCTTCCCATGTGATATATTCCAAG -3'

Posted On

2014-03-14