Incidental Mutation 'R1421:L2hgdh'
ID159827
Institutional Source Beutler Lab
Gene Symbol L2hgdh
Ensembl Gene ENSMUSG00000020988
Gene NameL-2-hydroxyglutarate dehydrogenase
Synonyms
MMRRC Submission 039477-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69690433-69724873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69701318 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 345 (D345N)
Ref Sequence ENSEMBL: ENSMUSP00000021370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021370]
Predicted Effect probably benign
Transcript: ENSMUST00000021370
AA Change: D345N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021370
Gene: ENSMUSG00000020988
AA Change: D345N

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
Pfam:DAO 51 457 1.9e-72 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes L-2-hydroxyglutarate dehydrogenase, a FAD-dependent enzyme that oxidizes L-2-hydroxyglutarate to alpha-ketoglutarate in a variety of mammalian tissues. Mutations in this gene cause L-2-hydroxyglutaric aciduria, a rare autosomal recessive neurometabolic disorder resulting in moderate to severe mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit increased levels of lysine and arginine associated with decreases in saccharopine, glutamine, and glutamate in adult brains, neurobehavioral deficits, and brain spongiosis with vacuolar lesions mostly affecting oligodendrocytes and myelin sheaths. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in L2hgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:L2hgdh APN 12 69701434 missense possibly damaging 0.67
IGL01505:L2hgdh APN 12 69721401 missense probably damaging 1.00
IGL01871:L2hgdh APN 12 69722095 missense probably damaging 1.00
IGL02169:L2hgdh APN 12 69721397 missense probably damaging 1.00
IGL02253:L2hgdh APN 12 69705760 splice site probably benign
IGL02670:L2hgdh APN 12 69692480 missense possibly damaging 0.86
IGL03069:L2hgdh APN 12 69692399 missense probably benign
R0054:L2hgdh UTSW 12 69721331 missense possibly damaging 0.82
R0106:L2hgdh UTSW 12 69705789 nonsense probably null
R0106:L2hgdh UTSW 12 69705789 nonsense probably null
R0579:L2hgdh UTSW 12 69701272 splice site probably benign
R1797:L2hgdh UTSW 12 69699566 missense probably benign
R3082:L2hgdh UTSW 12 69722084 missense probably benign 0.00
R7640:L2hgdh UTSW 12 69721357 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGAGGCAGTAAAGCATTACACTTGG -3'
(R):5'- ACTGTGCTAACCGTTCATCGTTGTG -3'

Sequencing Primer
(F):5'- TGGAAAAACCCTCTTGCTGG -3'
(R):5'- CTAACCGTTCATCGTTGTGTTGAG -3'
Posted On2014-03-14