Incidental Mutation 'R1421:Agtpbp1'
ID159828
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene NameATP/GTP binding protein 1
Synonyms2310001G17Rik, Nna1, 1700020N17Rik, 4930445M19Rik, 2900054O13Rik, 5730402G09Rik
MMRRC Submission 039477-MU
Accession Numbers

Genbank: NM_023328; MGI: 2159437

Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R1421 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59445742-59585227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59495575 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 717 (I717T)
Ref Sequence ENSEMBL: ENSMUSP00000132697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000022040] [ENSMUST00000022040] [ENSMUST00000109830] [ENSMUST00000109830] [ENSMUST00000109830] [ENSMUST00000164215] [ENSMUST00000164215] [ENSMUST00000164215] [ENSMUST00000165477] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000169745] [ENSMUST00000170555] [ENSMUST00000170555] [ENSMUST00000171606] [ENSMUST00000171606] [ENSMUST00000171606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022040
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000022040
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000022040
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109830
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109830
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109830
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163149
AA Change: I604T
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: I604T

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163149
AA Change: I604T
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: I604T

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163149
AA Change: I604T
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: I604T

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164215
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164215
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164215
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165477
Predicted Effect probably benign
Transcript: ENSMUST00000165477
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect possibly damaging
Transcript: ENSMUST00000170555
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170555
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171606
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171606
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171606
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Meta Mutation Damage Score 0.2848 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59450172 missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59462094 missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59504226 missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59508063 splice site probably benign
IGL01921:Agtpbp1 APN 13 59512483 missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59500461 missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59500489 missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59528419 missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59482601 missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59474589 missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59532080 splice site probably benign
IGL03218:Agtpbp1 APN 13 59500207 missense possibly damaging 0.94
drunk UTSW 13 59512323 critical splice donor site probably benign
gru UTSW 13 59473746 missense probably damaging 1.00
rio UTSW 13 59525241 critical splice acceptor site probably benign
wobble UTSW 13 59474550 missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59500200 missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59462031 missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59514152 missense probably damaging 0.99
R0559:Agtpbp1 UTSW 13 59497000 missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59533939 intron probably benign
R0943:Agtpbp1 UTSW 13 59500602 missense probably benign
R1196:Agtpbp1 UTSW 13 59450318 unclassified probably benign
R1531:Agtpbp1 UTSW 13 59500634 synonymous probably null
R1833:Agtpbp1 UTSW 13 59465983 critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59450202 missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59531058 missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59475803 frame shift probably null
R2006:Agtpbp1 UTSW 13 59500321 missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59474569 missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59497015 missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59460596 missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59500407 missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59528399 missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59500072 missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59500572 missense probably benign
R4969:Agtpbp1 UTSW 13 59500578 missense probably benign
R5066:Agtpbp1 UTSW 13 59474550 missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59500213 missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59500639 missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59473743 missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59482580 missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59500515 missense probably benign
R5824:Agtpbp1 UTSW 13 59466099 missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59534046 nonsense probably null
R6109:Agtpbp1 UTSW 13 59473746 missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59450300 missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59500020 missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59477040 missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59544353 intron probably null
R6950:Agtpbp1 UTSW 13 59450266 missense probably benign 0.32
R7030:Agtpbp1 UTSW 13 59504294 missense probably damaging 1.00
R7180:Agtpbp1 UTSW 13 59466038 missense probably benign 0.11
R7196:Agtpbp1 UTSW 13 59533180 missense possibly damaging 0.83
R7535:Agtpbp1 UTSW 13 59504253 missense probably benign
R7683:Agtpbp1 UTSW 13 59512498 missense probably damaging 1.00
R7713:Agtpbp1 UTSW 13 59514152 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCGCATCCCACTGACTTCAAAGTAG -3'
(R):5'- ACATTTGTTCAGCAAGGCAAAGCTC -3'

Sequencing Primer
(F):5'- TGACTTCAAAGTAGAACCACTGG -3'
(R):5'- GCAAGGCAAAGCTCACTATG -3'
Posted On2014-03-14