Incidental Mutation 'R1421:Agtpbp1'
ID 159828
Institutional Source Beutler Lab
Gene Symbol Agtpbp1
Ensembl Gene ENSMUSG00000021557
Gene Name ATP/GTP binding protein 1
Synonyms 2310001G17Rik, Ccp1, Nna1, 4930445M19Rik, 1700020N17Rik, 2900054O13Rik, 5730402G09Rik, atms
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.815) question?
Stock # R1421 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 59597348-59705184 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59643389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 717 (I717T)
Ref Sequence ENSEMBL: ENSMUSP00000132697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022040] [ENSMUST00000022040] [ENSMUST00000022040] [ENSMUST00000109830] [ENSMUST00000109830] [ENSMUST00000109830] [ENSMUST00000164215] [ENSMUST00000164215] [ENSMUST00000164215] [ENSMUST00000165477] [ENSMUST00000165477] [ENSMUST00000169745] [ENSMUST00000169745] [ENSMUST00000171606] [ENSMUST00000171606] [ENSMUST00000171606] [ENSMUST00000170555] [ENSMUST00000170555]
AlphaFold Q641K1
Predicted Effect possibly damaging
Transcript: ENSMUST00000022040
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000022040
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000022040
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022040
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 851 1099 1.7e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109830
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109830
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109830
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105456
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163149
AA Change: I604T
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: I604T

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163149
AA Change: I604T
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: I604T

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163149
AA Change: I604T
SMART Domains Protein: ENSMUSP00000126238
Gene: ENSMUSG00000021557
AA Change: I604T

DomainStartEndE-ValueType
low complexity region 250 279 N/A INTRINSIC
low complexity region 477 491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164215
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164215
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164215
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130939
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Pfam:Peptidase_M14 847 1123 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165477
Predicted Effect probably benign
Transcript: ENSMUST00000165477
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect probably benign
Transcript: ENSMUST00000169745
Predicted Effect possibly damaging
Transcript: ENSMUST00000171606
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171606
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171606
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132697
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.3e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170555
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000170555
AA Change: I717T

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128589
Gene: ENSMUSG00000021557
AA Change: I717T

DomainStartEndE-ValueType
Pfam:V-ATPase_H_N 34 309 2.4e-7 PFAM
low complexity region 362 391 N/A INTRINSIC
low complexity region 589 603 N/A INTRINSIC
low complexity region 787 795 N/A INTRINSIC
Meta Mutation Damage Score 0.2848 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NNA1 is a zinc carboxypeptidase that contains nuclear localization signals and an ATP/GTP-binding motif that was initially cloned from regenerating spinal cord neurons of the mouse.[supplied by OMIM, Jul 2002]
PHENOTYPE: Homozygotes show moderate ataxia due to degeneration of Purkinje cells of the cerebellum. Also, there is gradual degeneration of retina photoreceptor cells, olfactory bulb mitral cells and some thalamic neurons. Males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Gene trapped(6) Transgenic(1) Spontaneous(6) Chemically induced(4)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Atg16l1 T C 1: 87,714,080 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dnajc6 A T 4: 101,468,513 (GRCm39) Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Gm43302 T C 5: 105,365,215 (GRCm39) T598A probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Grhl2 A G 15: 37,309,960 (GRCm39) Y352C probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Ifitm2 T C 7: 140,534,972 (GRCm39) I121V probably benign Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lgals12 T C 19: 7,584,079 (GRCm39) H6R probably benign Het
Lrrc4b A G 7: 44,110,475 (GRCm39) I116V probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Slc6a12 T A 6: 121,336,085 (GRCm39) I352N probably damaging Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Ston1 T C 17: 88,943,221 (GRCm39) V209A probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Agtpbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Agtpbp1 APN 13 59,597,986 (GRCm39) missense probably damaging 1.00
IGL00808:Agtpbp1 APN 13 59,609,908 (GRCm39) missense possibly damaging 0.84
IGL01298:Agtpbp1 APN 13 59,652,040 (GRCm39) missense possibly damaging 0.77
IGL01628:Agtpbp1 APN 13 59,655,877 (GRCm39) splice site probably benign
IGL01921:Agtpbp1 APN 13 59,660,297 (GRCm39) missense possibly damaging 0.71
IGL02189:Agtpbp1 APN 13 59,648,275 (GRCm39) missense probably benign 0.01
IGL02325:Agtpbp1 APN 13 59,648,303 (GRCm39) missense probably benign 0.01
IGL02700:Agtpbp1 APN 13 59,676,233 (GRCm39) missense probably damaging 1.00
IGL02821:Agtpbp1 APN 13 59,630,415 (GRCm39) missense possibly damaging 0.69
IGL03130:Agtpbp1 APN 13 59,622,403 (GRCm39) missense possibly damaging 0.73
IGL03167:Agtpbp1 APN 13 59,679,894 (GRCm39) splice site probably benign
IGL03218:Agtpbp1 APN 13 59,648,021 (GRCm39) missense possibly damaging 0.94
bobs UTSW 13 59,630,385 (GRCm39) missense possibly damaging 0.53
drunk UTSW 13 59,660,136 (GRCm39) critical splice donor site probably benign
gru UTSW 13 59,621,560 (GRCm39) missense probably damaging 1.00
rio UTSW 13 59,673,055 (GRCm39) critical splice acceptor site probably benign
shreds UTSW 13 59,609,902 (GRCm39) missense probably damaging 1.00
Unfocused UTSW 13 59,609,884 (GRCm39) nonsense probably null
wobble UTSW 13 59,622,364 (GRCm39) missense probably damaging 1.00
R0025:Agtpbp1 UTSW 13 59,648,014 (GRCm39) missense probably benign 0.00
R0025:Agtpbp1 UTSW 13 59,648,014 (GRCm39) missense probably benign 0.00
R0276:Agtpbp1 UTSW 13 59,609,845 (GRCm39) missense possibly damaging 0.93
R0413:Agtpbp1 UTSW 13 59,661,966 (GRCm39) missense probably damaging 0.99
R0559:Agtpbp1 UTSW 13 59,644,814 (GRCm39) missense probably benign 0.32
R0848:Agtpbp1 UTSW 13 59,681,753 (GRCm39) intron probably benign
R0943:Agtpbp1 UTSW 13 59,648,416 (GRCm39) missense probably benign
R1196:Agtpbp1 UTSW 13 59,598,132 (GRCm39) unclassified probably benign
R1531:Agtpbp1 UTSW 13 59,648,448 (GRCm39) splice site probably null
R1833:Agtpbp1 UTSW 13 59,613,797 (GRCm39) critical splice donor site probably null
R1864:Agtpbp1 UTSW 13 59,598,016 (GRCm39) missense possibly damaging 0.92
R1994:Agtpbp1 UTSW 13 59,678,872 (GRCm39) missense probably damaging 1.00
R1995:Agtpbp1 UTSW 13 59,678,872 (GRCm39) missense probably damaging 1.00
R2001:Agtpbp1 UTSW 13 59,623,617 (GRCm39) frame shift probably null
R2006:Agtpbp1 UTSW 13 59,648,135 (GRCm39) missense probably benign 0.00
R2397:Agtpbp1 UTSW 13 59,622,383 (GRCm39) missense probably benign 0.10
R2918:Agtpbp1 UTSW 13 59,644,829 (GRCm39) missense possibly damaging 0.90
R3873:Agtpbp1 UTSW 13 59,608,410 (GRCm39) missense possibly damaging 0.88
R3924:Agtpbp1 UTSW 13 59,648,221 (GRCm39) missense probably benign 0.01
R4649:Agtpbp1 UTSW 13 59,676,213 (GRCm39) missense possibly damaging 0.89
R4913:Agtpbp1 UTSW 13 59,647,886 (GRCm39) missense probably damaging 1.00
R4933:Agtpbp1 UTSW 13 59,648,386 (GRCm39) missense probably benign
R4969:Agtpbp1 UTSW 13 59,648,392 (GRCm39) missense probably benign
R5066:Agtpbp1 UTSW 13 59,622,364 (GRCm39) missense probably damaging 1.00
R5139:Agtpbp1 UTSW 13 59,648,027 (GRCm39) missense probably damaging 0.99
R5194:Agtpbp1 UTSW 13 59,648,453 (GRCm39) missense probably benign 0.19
R5269:Agtpbp1 UTSW 13 59,621,557 (GRCm39) missense probably damaging 1.00
R5352:Agtpbp1 UTSW 13 59,621,560 (GRCm39) missense probably damaging 1.00
R5558:Agtpbp1 UTSW 13 59,630,394 (GRCm39) missense probably benign 0.05
R5687:Agtpbp1 UTSW 13 59,648,329 (GRCm39) missense probably benign
R5824:Agtpbp1 UTSW 13 59,613,913 (GRCm39) missense probably damaging 1.00
R5979:Agtpbp1 UTSW 13 59,681,860 (GRCm39) nonsense probably null
R6109:Agtpbp1 UTSW 13 59,621,560 (GRCm39) missense probably damaging 1.00
R6264:Agtpbp1 UTSW 13 59,598,114 (GRCm39) missense possibly damaging 0.89
R6413:Agtpbp1 UTSW 13 59,647,834 (GRCm39) missense possibly damaging 0.90
R6498:Agtpbp1 UTSW 13 59,624,854 (GRCm39) missense possibly damaging 0.71
R6747:Agtpbp1 UTSW 13 59,692,167 (GRCm39) splice site probably null
R6950:Agtpbp1 UTSW 13 59,598,080 (GRCm39) missense probably benign 0.32
R7030:Agtpbp1 UTSW 13 59,652,108 (GRCm39) missense probably damaging 1.00
R7180:Agtpbp1 UTSW 13 59,613,852 (GRCm39) missense probably benign 0.11
R7196:Agtpbp1 UTSW 13 59,680,994 (GRCm39) missense possibly damaging 0.83
R7535:Agtpbp1 UTSW 13 59,652,067 (GRCm39) missense probably benign
R7683:Agtpbp1 UTSW 13 59,660,312 (GRCm39) missense probably damaging 1.00
R7713:Agtpbp1 UTSW 13 59,661,966 (GRCm39) missense probably damaging 0.99
R8081:Agtpbp1 UTSW 13 59,676,221 (GRCm39) nonsense probably null
R8210:Agtpbp1 UTSW 13 59,630,385 (GRCm39) missense possibly damaging 0.53
R8861:Agtpbp1 UTSW 13 59,643,287 (GRCm39) missense probably damaging 1.00
R9163:Agtpbp1 UTSW 13 59,609,884 (GRCm39) nonsense probably null
R9199:Agtpbp1 UTSW 13 59,613,808 (GRCm39) missense probably benign 0.00
R9389:Agtpbp1 UTSW 13 59,613,884 (GRCm39) missense probably damaging 1.00
R9414:Agtpbp1 UTSW 13 59,609,902 (GRCm39) missense probably damaging 1.00
R9435:Agtpbp1 UTSW 13 59,622,429 (GRCm39) missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- CCGCATCCCACTGACTTCAAAGTAG -3'
(R):5'- ACATTTGTTCAGCAAGGCAAAGCTC -3'

Sequencing Primer
(F):5'- TGACTTCAAAGTAGAACCACTGG -3'
(R):5'- GCAAGGCAAAGCTCACTATG -3'
Posted On 2014-03-14