Incidental Mutation 'R1421:Nup155'
ID 159831
Institutional Source Beutler Lab
Gene Symbol Nup155
Ensembl Gene ENSMUSG00000022142
Gene Name nucleoporin 155
Synonyms D930027M19Rik
MMRRC Submission 039477-MU
Accession Numbers

Genbank: NM_133227
Essential gene? Essential (E-score: 1.000) question?
Stock # R1421 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 8109273-8161247 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8157760 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 1391 (H1391L)
Ref Sequence ENSEMBL: ENSMUSP00000128819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]
AlphaFold Q99P88
Predicted Effect probably damaging
Transcript: ENSMUST00000163765
AA Change: H1391L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: H1391L

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Nucleoporin_N 77 510 3.5e-105 PFAM
low complexity region 600 619 N/A INTRINSIC
Pfam:Nucleoporin_C 678 1221 3.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230925
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933416C03Rik A G 10: 116,113,438 V61A probably damaging Het
A2ml1 T C 6: 128,543,960 T1344A probably benign Het
Abcf1 G A 17: 35,960,909 A375V probably damaging Het
Adam20 T A 8: 40,796,747 H631Q possibly damaging Het
Adcy10 T C 1: 165,563,947 S1258P probably damaging Het
Agtpbp1 A G 13: 59,495,575 I717T possibly damaging Het
Ahnak T A 19: 9,015,631 F4760I possibly damaging Het
Ano6 A G 15: 95,913,385 K122R probably benign Het
Arhgap5 T C 12: 52,516,848 C201R probably damaging Het
Atg16l1 T C 1: 87,786,358 probably benign Het
Cdhr3 A T 12: 33,060,292 I331K probably damaging Het
Coq8a A G 1: 180,170,441 probably benign Het
Crebbp A G 16: 4,124,647 V662A probably damaging Het
Cspg4 T A 9: 56,896,626 M1667K probably benign Het
Dnah7a A G 1: 53,540,873 probably benign Het
Dnajc6 A T 4: 101,611,316 Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 M133K probably benign Het
Emb T C 13: 117,272,088 Y322H probably benign Het
Fam196a A T 7: 134,899,231 probably benign Het
Gcm1 A T 9: 78,059,700 H67L probably damaging Het
Gls2 A T 10: 128,201,348 K253* probably null Het
Gm28042 T A 2: 120,036,463 S196T probably benign Het
Gm43302 T C 5: 105,217,349 T598A probably benign Het
Gramd1a T A 7: 31,142,866 Q90L probably damaging Het
Grhl2 A G 15: 37,309,716 Y352C probably damaging Het
Ifi203-ps T C 1: 173,797,997 noncoding transcript Het
Ifitm2 T C 7: 140,955,059 I121V probably benign Het
Kptn T G 7: 16,123,024 probably benign Het
L2hgdh C T 12: 69,701,318 D345N probably benign Het
Lgals12 T C 19: 7,606,714 H6R probably benign Het
Lrrc4b A G 7: 44,461,051 I116V probably benign Het
Misp A G 10: 79,826,847 D366G probably damaging Het
Nav1 T C 1: 135,585,010 E104G probably damaging Het
Parp1 T C 1: 180,600,088 probably benign Het
Pikfyve G A 1: 65,271,311 G1919D probably damaging Het
Pomt1 A G 2: 32,236,753 probably benign Het
Prrc2b C T 2: 32,200,978 S454F possibly damaging Het
Selenbp1 T C 3: 94,943,872 S360P probably benign Het
Slc6a12 T A 6: 121,359,126 I352N probably damaging Het
Snx9 G A 17: 5,902,484 G197D probably benign Het
Ston1 T C 17: 88,635,793 V209A probably benign Het
Tex36 A T 7: 133,595,349 probably null Het
Tnnt3 A G 7: 142,511,366 E108G probably damaging Het
Vmn2r98 T A 17: 19,065,178 F87I probably damaging Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wdr64 T C 1: 175,767,150 I479T possibly damaging Het
Xrcc5 A G 1: 72,310,477 N22D probably benign Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp735 C A 11: 73,710,697 L156I probably benign Het
Zfp820 A T 17: 21,819,880 Y156N possibly damaging Het
Other mutations in Nup155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nup155 APN 15 8121455 splice site probably benign
IGL00426:Nup155 APN 15 8156794 makesense probably null
IGL00765:Nup155 APN 15 8153228 missense probably benign 0.16
IGL00936:Nup155 APN 15 8128405 splice site probably benign
IGL01124:Nup155 APN 15 8153679 missense probably damaging 0.97
IGL01739:Nup155 APN 15 8135788 missense probably benign 0.01
IGL02013:Nup155 APN 15 8113648 missense possibly damaging 0.61
IGL02066:Nup155 APN 15 8157766 unclassified probably benign
IGL02231:Nup155 APN 15 8144064 missense probably damaging 1.00
IGL02246:Nup155 APN 15 8143002 missense probably benign
IGL02289:Nup155 APN 15 8131493 missense probably damaging 1.00
IGL02608:Nup155 APN 15 8109471 missense probably benign
IGL02749:Nup155 APN 15 8134076 missense probably damaging 1.00
IGL02813:Nup155 APN 15 8130121 splice site probably benign
IGL03102:Nup155 APN 15 8147284 missense probably benign 0.00
H8930:Nup155 UTSW 15 8157658 missense possibly damaging 0.50
IGL02835:Nup155 UTSW 15 8143130 missense probably damaging 1.00
R0314:Nup155 UTSW 15 8147252 missense probably benign 0.00
R0365:Nup155 UTSW 15 8131543 missense probably damaging 1.00
R0586:Nup155 UTSW 15 8130232 missense probably benign 0.39
R0764:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R0839:Nup155 UTSW 15 8145587 missense possibly damaging 0.48
R0844:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1066:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1067:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1085:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1137:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1162:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1166:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1202:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1203:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1219:Nup155 UTSW 15 8117338 missense possibly damaging 0.80
R1385:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1448:Nup155 UTSW 15 8112406 missense probably benign 0.44
R1611:Nup155 UTSW 15 8130160 missense probably damaging 1.00
R1836:Nup155 UTSW 15 8154980 missense possibly damaging 0.79
R1863:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1866:Nup155 UTSW 15 8115526 missense probably damaging 1.00
R1894:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1976:Nup155 UTSW 15 8135827 missense probably benign 0.01
R2024:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2026:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2027:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2077:Nup155 UTSW 15 8143026 missense probably damaging 1.00
R2111:Nup155 UTSW 15 8121467 missense probably benign 0.45
R2921:Nup155 UTSW 15 8153641 missense probably damaging 1.00
R2936:Nup155 UTSW 15 8143049 missense possibly damaging 0.89
R3108:Nup155 UTSW 15 8117306 missense probably null 1.00
R3161:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3522:Nup155 UTSW 15 8156678 splice site probably benign
R4423:Nup155 UTSW 15 8121464 missense probably damaging 0.99
R4451:Nup155 UTSW 15 8150882 missense probably benign 0.02
R4498:Nup155 UTSW 15 8153673 missense possibly damaging 0.88
R4780:Nup155 UTSW 15 8157703 missense probably benign 0.00
R4822:Nup155 UTSW 15 8128526 missense possibly damaging 0.49
R5013:Nup155 UTSW 15 8124238 missense probably benign 0.00
R5064:Nup155 UTSW 15 8135870 missense probably damaging 1.00
R5172:Nup155 UTSW 15 8109542 missense probably benign 0.06
R5406:Nup155 UTSW 15 8153638 critical splice acceptor site probably null
R5551:Nup155 UTSW 15 8148333 missense probably benign 0.09
R5588:Nup155 UTSW 15 8119253 critical splice donor site probably null
R5977:Nup155 UTSW 15 8130237 critical splice donor site probably null
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6085:Nup155 UTSW 15 8148358 missense probably damaging 0.98
R6188:Nup155 UTSW 15 8109575 missense probably damaging 1.00
R6232:Nup155 UTSW 15 8109479 missense probably benign 0.02
R6257:Nup155 UTSW 15 8150798 nonsense probably null
R6262:Nup155 UTSW 15 8156741 missense probably benign 0.03
R6267:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6296:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6299:Nup155 UTSW 15 8128438 missense possibly damaging 0.88
R6303:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6304:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6763:Nup155 UTSW 15 8135895 nonsense probably null
R6958:Nup155 UTSW 15 8147154 missense probably damaging 1.00
R7088:Nup155 UTSW 15 8156693 missense probably benign 0.11
R7313:Nup155 UTSW 15 8154922 missense probably damaging 0.96
R7451:Nup155 UTSW 15 8145607 nonsense probably null
R7560:Nup155 UTSW 15 8155047 missense probably benign 0.39
R7633:Nup155 UTSW 15 8109453 missense probably damaging 0.99
R7670:Nup155 UTSW 15 8153696 missense probably damaging 0.99
R7726:Nup155 UTSW 15 8122139 missense probably damaging 1.00
R7752:Nup155 UTSW 15 8116442 missense possibly damaging 0.53
R7889:Nup155 UTSW 15 8121507 missense probably damaging 0.98
R7899:Nup155 UTSW 15 8119179 missense probably damaging 1.00
R7901:Nup155 UTSW 15 8116442 missense possibly damaging 0.53
R8429:Nup155 UTSW 15 8112420 missense probably damaging 0.96
R8467:Nup155 UTSW 15 8121531 missense probably benign 0.00
R8507:Nup155 UTSW 15 8147560 nonsense probably null
R8860:Nup155 UTSW 15 8130156 missense possibly damaging 0.96
R8994:Nup155 UTSW 15 8143161 critical splice donor site probably null
R9046:Nup155 UTSW 15 8128435 frame shift probably null
R9086:Nup155 UTSW 15 8148346 missense possibly damaging 0.84
R9500:Nup155 UTSW 15 8112316 missense probably damaging 1.00
RF003:Nup155 UTSW 15 8119176 critical splice acceptor site probably benign
RF048:Nup155 UTSW 15 8119176 critical splice acceptor site probably benign
Z1177:Nup155 UTSW 15 8120489 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTCAATGAGTGACCTGAAGTCTTTCTCC -3'
(R):5'- GGGAACAGACCCAGCCTATAAGGTG -3'

Sequencing Primer
(F):5'- GACCTGAAGTCTTTCTCCTTACAG -3'
(R):5'- TGGACCCAGCTGAGCTTTTA -3'
Posted On 2014-03-14