Incidental Mutation 'R1421:Grhl2'
ID 159832
Institutional Source Beutler Lab
Gene Symbol Grhl2
Ensembl Gene ENSMUSG00000022286
Gene Name grainyhead like transcription factor 2
Synonyms BOM, grainyheadlike, 0610015A08Rik, clft3, Tcfcp2l3
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1421 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 37233280-37363813 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37309960 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 352 (Y352C)
Ref Sequence ENSEMBL: ENSMUSP00000125410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022895] [ENSMUST00000161405]
AlphaFold Q8K5C0
Predicted Effect probably damaging
Transcript: ENSMUST00000022895
AA Change: Y352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022895
Gene: ENSMUSG00000022286
AA Change: Y352C

DomainStartEndE-ValueType
Pfam:CP2 214 438 8.5e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161405
AA Change: Y352C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125410
Gene: ENSMUSG00000022286
AA Change: Y352C

DomainStartEndE-ValueType
Pfam:CP2 209 434 2.1e-79 PFAM
Meta Mutation Damage Score 0.7742 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that can act as a homodimer or as a heterodimer with either GRHL1 or GRHL3. Defects in this gene are a cause of non-syndromic sensorineural deafness autosomal dominant type 28 (DFNA28).[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with cranioschisis, facial cleft, impaired neural fold elevation, and an open posterior neuropore. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Agtpbp1 A G 13: 59,643,389 (GRCm39) I717T possibly damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Atg16l1 T C 1: 87,714,080 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dnajc6 A T 4: 101,468,513 (GRCm39) Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Gm43302 T C 5: 105,365,215 (GRCm39) T598A probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Ifitm2 T C 7: 140,534,972 (GRCm39) I121V probably benign Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lgals12 T C 19: 7,584,079 (GRCm39) H6R probably benign Het
Lrrc4b A G 7: 44,110,475 (GRCm39) I116V probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Slc6a12 T A 6: 121,336,085 (GRCm39) I352N probably damaging Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Ston1 T C 17: 88,943,221 (GRCm39) V209A probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Grhl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Grhl2 APN 15 37,336,545 (GRCm39) missense probably damaging 1.00
IGL01730:Grhl2 APN 15 37,338,018 (GRCm39) missense probably benign 0.00
IGL02140:Grhl2 APN 15 37,270,830 (GRCm39) splice site probably benign
IGL02307:Grhl2 APN 15 37,288,532 (GRCm39) missense probably damaging 1.00
IGL02375:Grhl2 APN 15 37,291,821 (GRCm39) missense probably damaging 1.00
IGL02508:Grhl2 APN 15 37,310,009 (GRCm39) splice site probably benign
clayton UTSW 15 37,291,920 (GRCm39) splice site probably null
R0462:Grhl2 UTSW 15 37,344,919 (GRCm39) missense probably benign 0.00
R1548:Grhl2 UTSW 15 37,336,567 (GRCm39) missense probably benign 0.32
R1912:Grhl2 UTSW 15 37,358,651 (GRCm39) missense probably damaging 1.00
R1960:Grhl2 UTSW 15 37,336,558 (GRCm39) missense probably damaging 1.00
R3110:Grhl2 UTSW 15 37,336,591 (GRCm39) critical splice donor site probably null
R3112:Grhl2 UTSW 15 37,336,591 (GRCm39) critical splice donor site probably null
R4261:Grhl2 UTSW 15 37,361,067 (GRCm39) missense possibly damaging 0.64
R4830:Grhl2 UTSW 15 37,335,903 (GRCm39) splice site probably null
R4910:Grhl2 UTSW 15 37,291,920 (GRCm39) splice site probably null
R4929:Grhl2 UTSW 15 37,361,046 (GRCm39) missense probably benign
R4952:Grhl2 UTSW 15 37,287,493 (GRCm39) missense probably benign 0.13
R5742:Grhl2 UTSW 15 37,328,616 (GRCm39) missense probably damaging 1.00
R7142:Grhl2 UTSW 15 37,279,826 (GRCm39) missense probably benign 0.05
R7208:Grhl2 UTSW 15 37,335,980 (GRCm39) missense probably damaging 1.00
R7466:Grhl2 UTSW 15 37,291,860 (GRCm39) missense probably damaging 1.00
R7519:Grhl2 UTSW 15 37,336,556 (GRCm39) missense probably damaging 1.00
R7538:Grhl2 UTSW 15 37,328,603 (GRCm39) missense probably damaging 1.00
R7637:Grhl2 UTSW 15 37,328,574 (GRCm39) missense probably damaging 0.96
R8027:Grhl2 UTSW 15 37,279,727 (GRCm39) missense probably benign
R8047:Grhl2 UTSW 15 37,336,465 (GRCm39) missense probably benign 0.00
R8555:Grhl2 UTSW 15 37,233,507 (GRCm39) intron probably benign
R8818:Grhl2 UTSW 15 37,270,912 (GRCm39) missense probably damaging 1.00
R9117:Grhl2 UTSW 15 37,270,912 (GRCm39) missense probably damaging 1.00
R9339:Grhl2 UTSW 15 37,344,904 (GRCm39) missense probably benign 0.00
Z1177:Grhl2 UTSW 15 37,333,531 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCATGATGTGCTTGGTTCACAG -3'
(R):5'- TTGTCAGAGCAAAAGCTACACCTCC -3'

Sequencing Primer
(F):5'- TCACAGGCATGATGTGCTGAG -3'
(R):5'- TCCACAACGAAAGGTCAAAAGAG -3'
Posted On 2014-03-14