Mutagenetix > Incidental Mutation

Incidental Mutation 'R1421:Snx9'

159835

Institutional Source

Beutler Lab

Gene Symbol

Snx9

Ensembl Gene

ENSMUSG00000002365

Gene Name

sorting nexin 9

Synonyms

SH3PX1, SDP1

MMRRC Submission

039477-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.920) question?

Stock #

R1421 (G1)

Quality Score

195

Status

Validated

Chromosome

Chromosomal Location

5841329-5931954 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 5902484 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 197 (G197D)

Ref Sequence

ENSEMBL: ENSMUSP00000002436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002436]

AlphaFold

Q91VH2

PDB Structure

Solution structure of the SH3 domain from mouse sorting nexin-9 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000002436
AA Change: G197D

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000002436
Gene: ENSMUSG00000002365
AA Change: G197D

Domain	Start	End	E-Value	Type
SH3	3	61	1.51e-16	SMART
low complexity region	84	100	N/A	INTRINSIC
low complexity region	160	170	N/A	INTRINSIC
PX	247	357	4.15e-23	SMART
Pfam:BAR_3_WASP_bdg	358	593	2.4e-120	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.7%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phosphoinositide binding domain, and are involved in intracellular trafficking. The encoded protein does not contain a coiled coil region, like some family members, but does contain a SRC homology domain near its N-terminus. The encoded protein is reported to have a variety of interaction partners, including of adaptor protein 2 , dynamin, tyrosine kinase non-receptor 2, Wiskott-Aldrich syndrome-like, and ARP3 actin-related protein 3. The encoded protein is implicated in several stages of intracellular trafficking, including endocytosis, macropinocytosis, and F-actin nucleation. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	A	G	10: 116,113,438	V61A	probably damaging	Het
A2ml1	T	C	6: 128,543,960	T1344A	probably benign	Het
Abcf1	G	A	17: 35,960,909	A375V	probably damaging	Het
Adam20	T	A	8: 40,796,747	H631Q	possibly damaging	Het
Adcy10	T	C	1: 165,563,947	S1258P	probably damaging	Het
Agtpbp1	A	G	13: 59,495,575	I717T	possibly damaging	Het
Ahnak	T	A	19: 9,015,631	F4760I	possibly damaging	Het
Ano6	A	G	15: 95,913,385	K122R	probably benign	Het
Arhgap5	T	C	12: 52,516,848	C201R	probably damaging	Het
Atg16l1	T	C	1: 87,786,358		probably benign	Het
Cdhr3	A	T	12: 33,060,292	I331K	probably damaging	Het
Coq8a	A	G	1: 180,170,441		probably benign	Het
Crebbp	A	G	16: 4,124,647	V662A	probably damaging	Het
Cspg4	T	A	9: 56,896,626	M1667K	probably benign	Het
Dnah7a	A	G	1: 53,540,873		probably benign	Het
Dnajc6	A	T	4: 101,611,316	Y251F	probably damaging	Het
Dpy19l4	A	T	4: 11,304,011	M133K	probably benign	Het
Emb	T	C	13: 117,272,088	Y322H	probably benign	Het
Fam196a	A	T	7: 134,899,231		probably benign	Het
Gcm1	A	T	9: 78,059,700	H67L	probably damaging	Het
Gls2	A	T	10: 128,201,348	K253*	probably null	Het
Gm28042	T	A	2: 120,036,463	S196T	probably benign	Het
Gm43302	T	C	5: 105,217,349	T598A	probably benign	Het
Gramd1a	T	A	7: 31,142,866	Q90L	probably damaging	Het
Grhl2	A	G	15: 37,309,716	Y352C	probably damaging	Het
Ifi203-ps	T	C	1: 173,797,997		noncoding transcript	Het
Ifitm2	T	C	7: 140,955,059	I121V	probably benign	Het
Kptn	T	G	7: 16,123,024		probably benign	Het
L2hgdh	C	T	12: 69,701,318	D345N	probably benign	Het
Lgals12	T	C	19: 7,606,714	H6R	probably benign	Het
Lrrc4b	A	G	7: 44,461,051	I116V	probably benign	Het
Misp	A	G	10: 79,826,847	D366G	probably damaging	Het
Nav1	T	C	1: 135,585,010	E104G	probably damaging	Het
Nup155	A	T	15: 8,157,760	H1391L	probably damaging	Het
Parp1	T	C	1: 180,600,088		probably benign	Het
Pikfyve	G	A	1: 65,271,311	G1919D	probably damaging	Het
Pomt1	A	G	2: 32,236,753		probably benign	Het
Prrc2b	C	T	2: 32,200,978	S454F	possibly damaging	Het
Selenbp1	T	C	3: 94,943,872	S360P	probably benign	Het
Slc6a12	T	A	6: 121,359,126	I352N	probably damaging	Het
Ston1	T	C	17: 88,635,793	V209A	probably benign	Het
Tex36	A	T	7: 133,595,349		probably null	Het
Tnnt3	A	G	7: 142,511,366	E108G	probably damaging	Het
Vmn2r98	T	A	17: 19,065,178	F87I	probably damaging	Het
Vwa8	C	T	14: 78,908,230	R116C	probably damaging	Het
Wdr64	T	C	1: 175,767,150	I479T	possibly damaging	Het
Xrcc5	A	G	1: 72,310,477	N22D	probably benign	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp735	C	A	11: 73,710,697	L156I	probably benign	Het
Zfp820	A	T	17: 21,819,880	Y156N	possibly damaging	Het

Other mutations in Snx9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Snx9	APN	17	5899361	missense	probably benign
IGL00417:Snx9	APN	17	5891897	missense	probably benign	0.03
IGL01827:Snx9	APN	17	5887012	missense	probably benign	0.04
IGL02531:Snx9	APN	17	5891820	missense	probably benign
IGL02710:Snx9	APN	17	5908598	missense	probably damaging	1.00
IGL03088:Snx9	APN	17	5924610	missense	probably benign
san_angelo	UTSW	17	5891809	nonsense	probably null
PIT4495001:Snx9	UTSW	17	5920126	missense	possibly damaging	0.54
R0555:Snx9	UTSW	17	5918413	missense	probably damaging	0.97
R1015:Snx9	UTSW	17	5920127	missense	probably benign	0.12
R1065:Snx9	UTSW	17	5902361	splice site	probably benign
R1657:Snx9	UTSW	17	5918436	missense	possibly damaging	0.65
R1823:Snx9	UTSW	17	5920671	missense	probably damaging	1.00
R1914:Snx9	UTSW	17	5928256	missense	possibly damaging	0.65
R3703:Snx9	UTSW	17	5928200	splice site	probably null
R3871:Snx9	UTSW	17	5891781	missense	probably benign	0.00
R4375:Snx9	UTSW	17	5908626	nonsense	probably null
R4412:Snx9	UTSW	17	5908394	missense	probably damaging	0.96
R4669:Snx9	UTSW	17	5927224	missense	probably damaging	1.00
R4974:Snx9	UTSW	17	5902519	splice site	probably null
R5038:Snx9	UTSW	17	5887073	missense	probably benign	0.12
R5137:Snx9	UTSW	17	5928253	missense	probably damaging	1.00
R5369:Snx9	UTSW	17	5920580	missense	probably damaging	1.00
R5459:Snx9	UTSW	17	5920638	missense	probably damaging	0.99
R5624:Snx9	UTSW	17	5891809	nonsense	probably null
R5847:Snx9	UTSW	17	5924621	missense	possibly damaging	0.94
R5953:Snx9	UTSW	17	5908402	missense	probably damaging	1.00
R5953:Snx9	UTSW	17	5908403	missense	probably damaging	1.00
R6263:Snx9	UTSW	17	5887049	missense	probably damaging	0.98
R6481:Snx9	UTSW	17	5922209	critical splice donor site	probably null
R6491:Snx9	UTSW	17	5920162	missense	probably benign	0.00
R7873:Snx9	UTSW	17	5918476	missense	possibly damaging	0.81
R8471:Snx9	UTSW	17	5890090	missense	probably damaging	1.00
R9451:Snx9	UTSW	17	5899493	missense	probably damaging	0.99
R9748:Snx9	UTSW	17	5899395	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTTAATGCCGACTGCAAAGCCTG -3'
(R):5'- TTCTTACATTGCACGCACGCAC -3'

Sequencing Primer
(F):5'- TGCAAAGCCTGTGCTCTAAAG -3'
(R):5'- cgcacgcacgctcatac -3'

Posted On

2014-03-14