Incidental Mutation 'R1421:Ston1'
ID 159839
Institutional Source Beutler Lab
Gene Symbol Ston1
Ensembl Gene ENSMUSG00000033855
Gene Name stonin 1
Synonyms 4921524J06Rik
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.323) question?
Stock # R1421 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 88905043-88955293 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88943221 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 209 (V209A)
Ref Sequence ENSEMBL: ENSMUSP00000118522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064035] [ENSMUST00000137138] [ENSMUST00000150023] [ENSMUST00000163588]
AlphaFold Q8CDJ8
Predicted Effect probably benign
Transcript: ENSMUST00000064035
AA Change: V209A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000067027
Gene: ENSMUSG00000033855
AA Change: V209A

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132384
Predicted Effect probably benign
Transcript: ENSMUST00000137138
AA Change: V209A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000118522
Gene: ENSMUSG00000033855
AA Change: V209A

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150023
AA Change: V209A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122928
Gene: ENSMUSG00000033855
AA Change: V209A

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153613
Predicted Effect probably benign
Transcript: ENSMUST00000163588
AA Change: V209A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131703
Gene: ENSMUSG00000033855
AA Change: V209A

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 711 2.1e-64 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal. Mouse embryonic fibroblasts derived from homozygous null mice display alterations in focal adhesion dynamics and an increase in cellular signaling and directional cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Agtpbp1 A G 13: 59,643,389 (GRCm39) I717T possibly damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Atg16l1 T C 1: 87,714,080 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dnajc6 A T 4: 101,468,513 (GRCm39) Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Gm43302 T C 5: 105,365,215 (GRCm39) T598A probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Grhl2 A G 15: 37,309,960 (GRCm39) Y352C probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Ifitm2 T C 7: 140,534,972 (GRCm39) I121V probably benign Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lgals12 T C 19: 7,584,079 (GRCm39) H6R probably benign Het
Lrrc4b A G 7: 44,110,475 (GRCm39) I116V probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Slc6a12 T A 6: 121,336,085 (GRCm39) I352N probably damaging Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Ston1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Ston1 APN 17 88,951,871 (GRCm39) missense probably benign 0.00
IGL01593:Ston1 APN 17 88,944,438 (GRCm39) missense probably null 1.00
BB010:Ston1 UTSW 17 88,943,572 (GRCm39) missense probably benign 0.10
BB020:Ston1 UTSW 17 88,943,572 (GRCm39) missense probably benign 0.10
FR4449:Ston1 UTSW 17 88,942,953 (GRCm39) missense probably benign 0.38
R0610:Ston1 UTSW 17 88,942,709 (GRCm39) missense possibly damaging 0.49
R1620:Ston1 UTSW 17 88,943,244 (GRCm39) missense probably benign 0.01
R2002:Ston1 UTSW 17 88,942,957 (GRCm39) missense probably benign 0.01
R3108:Ston1 UTSW 17 88,943,583 (GRCm39) nonsense probably null
R3766:Ston1 UTSW 17 88,942,788 (GRCm39) missense probably damaging 1.00
R4222:Ston1 UTSW 17 88,944,199 (GRCm39) missense probably damaging 1.00
R4335:Ston1 UTSW 17 88,943,125 (GRCm39) missense probably damaging 1.00
R4355:Ston1 UTSW 17 88,944,436 (GRCm39) missense probably damaging 1.00
R4867:Ston1 UTSW 17 88,943,122 (GRCm39) missense probably damaging 1.00
R4902:Ston1 UTSW 17 88,952,680 (GRCm39) missense probably damaging 0.99
R5084:Ston1 UTSW 17 88,944,002 (GRCm39) missense probably benign 0.00
R5434:Ston1 UTSW 17 88,952,739 (GRCm39) utr 3 prime probably benign
R5700:Ston1 UTSW 17 88,951,767 (GRCm39) missense probably damaging 1.00
R5858:Ston1 UTSW 17 88,943,059 (GRCm39) missense possibly damaging 0.93
R5863:Ston1 UTSW 17 88,943,373 (GRCm39) missense possibly damaging 0.64
R6458:Ston1 UTSW 17 88,942,731 (GRCm39) missense probably benign 0.14
R6459:Ston1 UTSW 17 88,943,896 (GRCm39) missense probably benign 0.16
R7012:Ston1 UTSW 17 88,943,413 (GRCm39) missense probably damaging 1.00
R7466:Ston1 UTSW 17 88,943,329 (GRCm39) missense probably benign 0.03
R7825:Ston1 UTSW 17 88,943,881 (GRCm39) missense possibly damaging 0.78
R7933:Ston1 UTSW 17 88,943,572 (GRCm39) missense probably benign 0.10
R8505:Ston1 UTSW 17 88,943,017 (GRCm39) missense probably benign 0.35
R8876:Ston1 UTSW 17 88,942,600 (GRCm39) missense probably benign
R9050:Ston1 UTSW 17 88,944,228 (GRCm39) missense probably benign 0.00
R9429:Ston1 UTSW 17 88,943,034 (GRCm39) missense probably benign
R9798:Ston1 UTSW 17 88,944,472 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATGTATCGTTACCCAGTAGCCAC -3'
(R):5'- TCAGCATGAAGGACCATCCAGCTC -3'

Sequencing Primer
(F):5'- ACACTCGGTTTTACAGAAGACG -3'
(R):5'- AGCTCTGGGCTGACTCC -3'
Posted On 2014-03-14