Incidental Mutation 'R1421:Lgals12'
ID 159841
Institutional Source Beutler Lab
Gene Symbol Lgals12
Ensembl Gene ENSMUSG00000024972
Gene Name lectin, galactose binding, soluble 12
Synonyms galectin-12, galectin-related inhibitor of proliferation, GRIP1
MMRRC Submission 039477-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1421 (G1)
Quality Score 192
Status Validated
Chromosome 19
Chromosomal Location 7574025-7584558 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7584079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 6 (H6R)
Ref Sequence ENSEMBL: ENSMUSP00000124610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079902] [ENSMUST00000099729] [ENSMUST00000159983]
AlphaFold Q91VD1
Predicted Effect probably benign
Transcript: ENSMUST00000079902
AA Change: H6R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000078824
Gene: ENSMUSG00000024972
AA Change: H6R

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 181 301 3.6e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099729
AA Change: H6R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097318
Gene: ENSMUSG00000024972
AA Change: H6R

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159983
AA Change: H6R

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000124610
Gene: ENSMUSG00000024972
AA Change: H6R

DomainStartEndE-ValueType
GLECT 25 161 1.18e-33 SMART
Gal-bind_lectin 31 160 1.45e-48 SMART
Gal-bind_lectin 194 314 3.6e-12 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the galectin superfamily, a group of beta-galactoside-binding proteins with conserved carbohydrate recognition domains. The related mouse protein is a primary regulator of the early stages of adipose tissue development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased lipolysis, reduced adiposity, and enhanced insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,923 (GRCm39) T1344A probably benign Het
Abcf1 G A 17: 36,271,801 (GRCm39) A375V probably damaging Het
Adam20 T A 8: 41,249,784 (GRCm39) H631Q possibly damaging Het
Adcy10 T C 1: 165,391,516 (GRCm39) S1258P probably damaging Het
Agtpbp1 A G 13: 59,643,389 (GRCm39) I717T possibly damaging Het
Ahnak T A 19: 8,992,995 (GRCm39) F4760I possibly damaging Het
Ano6 A G 15: 95,811,266 (GRCm39) K122R probably benign Het
Arhgap5 T C 12: 52,563,631 (GRCm39) C201R probably damaging Het
Atg16l1 T C 1: 87,714,080 (GRCm39) probably benign Het
Cdhr3 A T 12: 33,110,291 (GRCm39) I331K probably damaging Het
Coq8a A G 1: 179,998,006 (GRCm39) probably benign Het
Crebbp A G 16: 3,942,511 (GRCm39) V662A probably damaging Het
Cspg4 T A 9: 56,803,910 (GRCm39) M1667K probably benign Het
Dnah7a A G 1: 53,580,032 (GRCm39) probably benign Het
Dnajc6 A T 4: 101,468,513 (GRCm39) Y251F probably damaging Het
Dpy19l4 A T 4: 11,304,011 (GRCm39) M133K probably benign Het
Emb T C 13: 117,408,624 (GRCm39) Y322H probably benign Het
Gcm1 A T 9: 77,966,982 (GRCm39) H67L probably damaging Het
Gls2 A T 10: 128,037,217 (GRCm39) K253* probably null Het
Gm28042 T A 2: 119,866,944 (GRCm39) S196T probably benign Het
Gm43302 T C 5: 105,365,215 (GRCm39) T598A probably benign Het
Gramd1a T A 7: 30,842,291 (GRCm39) Q90L probably damaging Het
Grhl2 A G 15: 37,309,960 (GRCm39) Y352C probably damaging Het
Ifi203-ps T C 1: 173,625,563 (GRCm39) noncoding transcript Het
Ifitm2 T C 7: 140,534,972 (GRCm39) I121V probably benign Het
Insyn2a A T 7: 134,500,960 (GRCm39) probably benign Het
Kptn T G 7: 15,856,949 (GRCm39) probably benign Het
L2hgdh C T 12: 69,748,092 (GRCm39) D345N probably benign Het
Lrrc4b A G 7: 44,110,475 (GRCm39) I116V probably benign Het
Misp A G 10: 79,662,681 (GRCm39) D366G probably damaging Het
Nav1 T C 1: 135,512,748 (GRCm39) E104G probably damaging Het
Nup155 A T 15: 8,187,244 (GRCm39) H1391L probably damaging Het
Parp1 T C 1: 180,427,653 (GRCm39) probably benign Het
Pikfyve G A 1: 65,310,470 (GRCm39) G1919D probably damaging Het
Pomt1 A G 2: 32,126,765 (GRCm39) probably benign Het
Prrc2b C T 2: 32,090,990 (GRCm39) S454F possibly damaging Het
Selenbp1 T C 3: 94,851,183 (GRCm39) S360P probably benign Het
Slc6a12 T A 6: 121,336,085 (GRCm39) I352N probably damaging Het
Snx9 G A 17: 5,952,759 (GRCm39) G197D probably benign Het
Ston1 T C 17: 88,943,221 (GRCm39) V209A probably benign Het
Taf7l2 A G 10: 115,949,343 (GRCm39) V61A probably damaging Het
Tex36 A T 7: 133,197,078 (GRCm39) probably null Het
Tnnt3 A G 7: 142,065,103 (GRCm39) E108G probably damaging Het
Vmn2r98 T A 17: 19,285,440 (GRCm39) F87I probably damaging Het
Vwa8 C T 14: 79,145,670 (GRCm39) R116C probably damaging Het
Wdr64 T C 1: 175,594,716 (GRCm39) I479T possibly damaging Het
Xrcc5 A G 1: 72,349,636 (GRCm39) N22D probably benign Het
Zfp407 C T 18: 84,577,898 (GRCm39) A1072T probably benign Het
Zfp735 C A 11: 73,601,523 (GRCm39) L156I probably benign Het
Zfp820 A T 17: 22,038,861 (GRCm39) Y156N possibly damaging Het
Other mutations in Lgals12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Lgals12 APN 19 7,584,019 (GRCm39) splice site probably benign
IGL02630:Lgals12 APN 19 7,578,607 (GRCm39) splice site probably benign
IGL02700:Lgals12 APN 19 7,575,455 (GRCm39) missense probably benign 0.01
R0129:Lgals12 UTSW 19 7,580,403 (GRCm39) missense probably damaging 0.99
R1398:Lgals12 UTSW 19 7,581,322 (GRCm39) splice site probably benign
R1548:Lgals12 UTSW 19 7,581,677 (GRCm39) missense probably benign 0.12
R1697:Lgals12 UTSW 19 7,581,530 (GRCm39) missense possibly damaging 0.91
R2075:Lgals12 UTSW 19 7,576,210 (GRCm39) missense possibly damaging 0.81
R2192:Lgals12 UTSW 19 7,578,606 (GRCm39) splice site probably null
R2253:Lgals12 UTSW 19 7,584,130 (GRCm39) start gained probably benign
R4256:Lgals12 UTSW 19 7,584,081 (GRCm39) missense possibly damaging 0.93
R4738:Lgals12 UTSW 19 7,581,464 (GRCm39) missense probably benign 0.01
R5495:Lgals12 UTSW 19 7,581,495 (GRCm39) missense probably damaging 1.00
R5810:Lgals12 UTSW 19 7,584,085 (GRCm39) missense probably benign 0.00
R6139:Lgals12 UTSW 19 7,581,742 (GRCm39) missense probably benign 0.07
R7414:Lgals12 UTSW 19 7,581,335 (GRCm39) missense probably damaging 1.00
R8755:Lgals12 UTSW 19 7,581,345 (GRCm39) missense possibly damaging 0.95
R8920:Lgals12 UTSW 19 7,576,166 (GRCm39) missense possibly damaging 0.55
R9334:Lgals12 UTSW 19 7,578,086 (GRCm39) missense probably benign 0.01
R9441:Lgals12 UTSW 19 7,581,356 (GRCm39) missense probably damaging 1.00
X0067:Lgals12 UTSW 19 7,581,329 (GRCm39) splice site probably null
Z1177:Lgals12 UTSW 19 7,575,445 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGTCCCTCATAGCAATCCACCTC -3'
(R):5'- AGCAAAGCTGCTGCTGTACCATC -3'

Sequencing Primer
(F):5'- TCATAGCAATCCACCTCCATTC -3'
(R):5'- TGCTGTACCATCATAGCGG -3'
Posted On 2014-03-14