Incidental Mutation 'R1417:G6pc2'
ID159844
Institutional Source Beutler Lab
Gene Symbol G6pc2
Ensembl Gene ENSMUSG00000005232
Gene Nameglucose-6-phosphatase, catalytic, 2
SynonymsIGRP, G6pc-rs, islet specific glucose-6-phosphatase
MMRRC Submission 039473-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R1417 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69211073-69227841 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69222968 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 122 (V122A)
Ref Sequence ENSEMBL: ENSMUSP00000107936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005364] [ENSMUST00000112317]
Predicted Effect probably damaging
Transcript: ENSMUST00000005364
AA Change: V122A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005364
Gene: ENSMUSG00000005232
AA Change: V122A

DomainStartEndE-ValueType
acidPPc 53 194 7.83e-21 SMART
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 254 273 N/A INTRINSIC
transmembrane domain 319 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112317
AA Change: V122A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107936
Gene: ENSMUSG00000005232
AA Change: V122A

DomainStartEndE-ValueType
SCOP:d1d2ta_ 6 126 5e-13 SMART
Blast:acidPPc 53 147 1e-65 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151953
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the glucose-6-phosphatase catalytic subunit family. Members of this family catalyze the hydrolysis of glucose-6-phosphate, the terminal step in gluconeogenic and glycogenolytic pathways, to release glucose into the bloodstream. The family member encoded by this gene is found specifically in pancreatic islets but has not been shown to have phosphotransferase or phosphatase activity exhibited by a similar liver enzyme. The non-obese diabetic (NOD) mouse is a model for human type 1 diabetes, an autoimmune disease in which T lymphocytes attack and destroy insulin-producing pancreatic beta cells. In NOD mice, the protein encoded by this gene is a major target of cell-mediated autoimmunity. Variations in the human and mouse genes are associated with lower fasting plasma glucose levels. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a disruption of this gene show a significant drop in fasting blood glucose. Females also show a significant drop in plasma triacylglycerol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 A G 16: 29,298,235 V565A probably benign Het
Atp6v1b1 T C 6: 83,753,880 S196P probably damaging Het
Car9 G T 4: 43,512,439 probably null Het
Ces1a C T 8: 93,022,416 D456N probably benign Het
Clu T A 14: 65,974,971 Y124* probably null Het
Cnnm1 A G 19: 43,469,723 E658G probably benign Het
Dnah9 T C 11: 65,955,747 E2913G probably damaging Het
Edc4 G A 8: 105,887,855 probably null Het
Enox1 C T 14: 77,486,005 probably benign Het
Galns T C 8: 122,584,913 S453G possibly damaging Het
Gm12185 A C 11: 48,907,842 V608G probably damaging Het
Hbq1a A G 11: 32,300,722 D135G probably benign Het
Hspg2 A G 4: 137,517,636 T891A probably benign Het
Ift172 T C 5: 31,256,649 Y1445C probably damaging Het
Ipo8 C T 6: 148,818,052 D132N probably benign Het
Klhl11 T C 11: 100,472,289 E147G probably benign Het
Kmt2d A T 15: 98,866,430 V41D probably damaging Het
Lrp1b T C 2: 41,004,641 I2306V probably benign Het
Lrp5 A G 19: 3,586,425 V1514A probably benign Het
Lrrtm2 A T 18: 35,213,958 I97N probably damaging Het
Mtmr3 C A 11: 4,487,923 V844L probably benign Het
Myh8 A G 11: 67,306,185 E1832G probably damaging Het
Olfr722 T A 14: 49,895,563 R80* probably null Het
Pcdhb16 A G 18: 37,478,127 T47A probably benign Het
Pfkp T C 13: 6,605,719 K293E probably benign Het
Phlpp2 G T 8: 109,940,681 E1281* probably null Het
Prss23 T A 7: 89,510,184 T226S probably damaging Het
Slc8a1 T G 17: 81,408,280 M775L probably damaging Het
Stx12 A G 4: 132,860,542 probably null Het
Syt11 A T 3: 88,761,982 I201N probably damaging Het
Ttc21a A G 9: 119,954,261 N543S probably damaging Het
Usf3 A G 16: 44,217,449 N764S probably benign Het
Xylb A G 9: 119,364,540 D100G probably benign Het
Zfp423 T C 8: 87,773,656 probably null Het
Zkscan16 T C 4: 58,952,377 V225A probably benign Het
Other mutations in G6pc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01571:G6pc2 APN 2 69222967 missense probably damaging 1.00
IGL02031:G6pc2 APN 2 69222991 missense probably benign 0.36
IGL02504:G6pc2 APN 2 69226595 missense probably damaging 0.99
IGL02674:G6pc2 APN 2 69226566 critical splice acceptor site probably null
IGL03339:G6pc2 APN 2 69220895 splice site probably benign
R0011:G6pc2 UTSW 2 69226565 splice site probably benign
R1113:G6pc2 UTSW 2 69220226 missense probably damaging 1.00
R1308:G6pc2 UTSW 2 69220226 missense probably damaging 1.00
R1441:G6pc2 UTSW 2 69220854 missense probably damaging 0.97
R1658:G6pc2 UTSW 2 69227069 missense probably damaging 1.00
R1762:G6pc2 UTSW 2 69220842 missense possibly damaging 0.53
R1768:G6pc2 UTSW 2 69222977 missense probably damaging 1.00
R3161:G6pc2 UTSW 2 69220112 missense probably damaging 0.98
R5487:G6pc2 UTSW 2 69226577 missense probably damaging 0.99
R5623:G6pc2 UTSW 2 69226583 missense probably damaging 1.00
R5686:G6pc2 UTSW 2 69220784 missense probably benign 0.03
R7493:G6pc2 UTSW 2 69223000 missense probably benign 0.00
R7733:G6pc2 UTSW 2 69220183 nonsense probably null
X0040:G6pc2 UTSW 2 69223010 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CGATGGAATCGTCTGAGGAAATCACAC -3'
(R):5'- TGGAATCCCAAAGGCGTATTTAGCAAG -3'

Sequencing Primer
(F):5'- GTCTCAAACGGACTCAGTTTGTC -3'
(R):5'- TCTGCTACATGGGCTATGAAAG -3'
Posted On2014-03-14